BME100 f2013:W1200 Group18 L6

BME 100 Fall 2013	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Name: Nikhil Patel Name: Carlyn Harris Name: student Name: student Name: student Name: Matthew Armas [Instructions: add the name of your team's company and/or product here] LAB 6 WRITE-UP Computer-Aided Design TinkerCAD TinkerCAD is a website that has a tool where you create objects. When using the tool, your work space is on a flat plain. On that plain you can use different objects and put them together to create a whole new object. Once created you can then print the object to from a 3D printer to create a model of the object. TinkerCAD is an easy to use site and tool to where you can create, share, and print your objects. ASU colors to make it look awesome. GO ASU! Implications of Using TinkerCAD for Design [Instructions: A short paragraph discussing just one possible way to use TinkerCAD for something practical...like redesigning the OpenPCR machine, fluorimeter, camera holder, printing out some of the smaller plastic items on demand, etc. There are lots of possibilities...pick just ONE.]Redesigning something like the OpenPCR machine could be beneficialin its own way. If a part in the OpenPCR machine is broken and needs to be replaced, then using TinkerCAD you can make a new model of the broken part and print from t a 3D printer. Infact you could redesign the entire OpenPCR machine to be lighter and smaller. Using TInkerCAd is significantlly easy and printing isn't that hard either, with just a few minutes on TinkerCAD and the 3D printer you could easily make a few more OpenPCR machines. Feature 1: Cancer SNP-Specific Primers [Instructions: This information will come from the Week 9 exercises you did in lab. Your notes should be in a pdf file that is saved on Blackboard under your group.] Background on the cancer-associated mutation A nucleotide consists of a nucleotide base, a phosphate group and a five carbon sugar and a polymorphism is one or more variation of a particular DNA. rs17879961 is a single nucleotide polymorphism that is expressed in homo sapiens. This pathogen is located on the 22nd chromosome and its main function is altering the CHEK2. CHEK2 stands for checkpoint kinase 2 and its main function is to prevent mitosis and tumor growth and it is activated when a damaged DNA is detected. Primer design Forward Primer: 5'TGTAAGGACAGGACCAAATTT Cancer-specific Reverse Primer: 5'TGTAAGAGTTTTTAGGAACC How the primers work: Primers are the starting point for DNA replication and consist of a strand of nucleic acid that is complementary to the DNA strand. The reverse primer binds to the complementary cancer containing template. The primer will only bind to the complementary strand and therefor it will only replicate DNA with the cancer allele. Feature 2: Consumables Kit In our kit, the consumables will be packaged in a different way. The disposable tips (for the micropipette), for example, will arrive neatly in a box. There will be a user-friendly instruction manual included. Lastly, the dye will be packaged in a sleeve. This new packaging method addresses a couple of major weaknesses. Currently, the disposable tips are thrown haphazardly into plastic bag. Even with gloves on, this setup makes it difficult for the consumer to get one or two tips out of the bag without contaminating the others. A box with a slot for each tip makes this process more efficient. On the issue of contamination, a brief instruction manual is necessary in order to educate the consumer on how to best handle the materials. It is a mistake to assume that everybody who orders this kit will be familiar with it. The sleeve for the dye is important as well; it prevents unnecessary light exposure, especially when the box is first opened and the dye is not used immediately. It is a known fact that light destroys its properties. When faulty dye is used, it can affect the results of an experiment. So will any unnecessary contamination of the tips and other included materials. Feature 3: PCR Machine Hardware [Instructions: Summarize how you will include the PCR machine in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.] [Instructions: IF your group has decided to redesign the PCR machine to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Feature 4: Fluorimeter Hardware [Instructions: Summarize how you will include the fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really REALLY awesome and easy to score.] In our system, all the necessary equipment (the box, camera stand, disposable slides, and fluorimeter) will be included. The box will be able to block out all the external light. The only redesign to the fluorimeter system is to include a better box that will block out all light. The light from the surroundings can affect the clarity of the pictures and thus, the results of the experiment. The Disposable slides, on the other hand, are a strength because they are disposable. In other words, this minimizes the amount of contamination. [Instructions: IF your group has decided to redesign the fluorimeter to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach The result for calculation 3 describes the probability that the patient will actually develop cancer given that they have a positive DNA cancer sequence from the CHEK2 P test (P(A|B)). The P(B|A) value which represents the fraction of non-cancer DNA sequences that also are given a "no" to developing cancer was significantly under one as was the P(A|B) value. This signifies that the CHEK2 PCR test is not very reliable according this calculation as the probability a patient has cancer given a cancer DNA sequence is very small because a very large amount of positive PCR conclusions resulted in a non-cancerous biopsy report. The results for calculation 3 describe the probability that the patient does not have cancer given a non-cancer DNA sequence with the CHEK2 PCR test. The P(B|A) value, representing the fraction of non cancer DNA sequence occuring given a "no" on developing cancer was closer to 1 than it's respective value in calculation 3 but still not convincing enough. It would be most convincing if this number was much closer to one. In turn, the P(A|B) value was closer to 1 than it's respective value in calculation 3. This calculation demonstrates the PCR test as slightly more reliable as the probability that the patient will not have cancer given a non cancer sequence is closer to one. However, many negative PCR conclusions still resulted in a cancerous biopsy. Even the slightest chance that a patient with cancer could be diagnosed without it using this test is not something that should be relied upon. Therefore, it seems that the CHEK2 PCR test performed in lab was more reliable when detecting a non cancer DNA sequence than a cancer DNA sequence but still not convincing.