BME100 f2013:W1200 Group16 L6

From OpenWetWare
Jump to navigationJump to search
BME 100 Fall 2013 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR COMPANY: Polly

Name: Rene Reynolds
Name: Mychal Hooser
Name: Ayanna Akinyemi
Name: John Jakoubek
Name: Courtney Willson




LAB 6 WRITE-UP

Computer-Aided Design

TinkerCAD


Tinkercad is a program that can be used to build 3D models. In lab we found the Tinkercad file of the eppendorf or PCR tubes and changed it to our own way. What our group did was connected all the tubes together so they wouldn't get lost as easily and are easier to carry and move around all at once. Also, we changed the way the lid closes to make it a better sealed container. Lastly, we changed some of the colors of the original tube design to add our own personal touch.

Implications of Using TinkerCAD for Design

TinkerCAD can be used for many things in the world of engineering. However, some of its most practical uses come in handy when trying to design the smaller plastic pieces on demand in lab. As mentioned above, TinkerCAD can be effectively used to enhance previous eppendorfs to make them more user-friendly. Adding measurements to the tubes as well as connecting them enhances the design. Also, on TinkerCAD it is possible to add letters and numbers to a design, so an alpha-numeric grid system could be placed on the outside holder to confirm which tube is next to be pipetted. (In example : A1, A2, A3, etc...). This will ultimately diffuse any confusion the user may have about where to pipette from. TinkerCAD makes enhancing problematic defects much easier and convenient.



Feature 1: Cancer SNP-Specific Primers

Background on the cancer-associated mutation

Nucleotides are essentially the building blocks of DNA and RNA. They are composed of a sugar molecule, a phosphate group, and a nucleic base. In DNA, the sugar molecule is deoxyribose and the purine bases include adenine and guanine while the pyrimidine bases include thymine and cytosine. In RNA, the sugar molecule is ribose and the purine bases include adenine and guanine while the pyrimidine bases include cytosine and uracil (instead of thymine). Polymorphism is when there are two or more differences between two of the same DNA sequences. The rs17879961 variation is only found in homosapiens and the clinical significance of this single nucleotide polymorphism (SNP) is pathogenic. The SNP rs17879961 is on chromosome number 22 out of the 23 chromosomes that humans typically have, indicating where the polymorphism occurs. The affected gene in SNP rs17879961 is Kinase 2. The reason why the SNP occurs here is because there is damage to the DNA or stoppage in replication forcing the cell cycle regulators to halt the cell cycle.


Primer design

  • Forward Primer: TGTAAGGACAGGACAAATTT
  • Cancer-specific Reverse Primer: GGTCCTAAAAACTCTTACAC

Primers are made to specifically focus on a certain segment of the DNA sequence, and in this case the primers are made specifically for the SNP rs17879961



Feature 2: Consumables Kit

Our consumables kit will contain eppendorfs with a cap that will allow the tip of the pipette to draw as much fluid as desired by the user. Also, our kit is going to contain an organization apparatus that somewhat resembles a fishing tackle-box. The foldable shelves will ensure that the primers, tips, tubes, PCR mix, and micropipettor are not only separated in an orderly fashion, but securely fastened to ensure that nothing gets lost,broken, or contaminated. These measures will ultimately solve the contamination problem and fix the previous design flaws.







[Instructions: IF your consumables packaging plan addresses any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.]

Feature 3: PCR Machine Hardware

[Instructions: Summarize how you will include the PCR machine in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.]

[Instructions: IF your group has decided to redesign the PCR machine to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.]


Feature 4: Fluorimeter Hardware

[Instructions: Summarize how you will include the fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really REALLY awesome and easy to score.]

[Instructions: IF your group has decided to redesign the fluorimeter to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.]


Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach

[Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of CHEK2 PCR for predicting cancer. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via e-mail. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]