BME100 f2013:W1200 Group15 L6: Difference between revisions
No edit summary |
No edit summary |
||
(24 intermediate revisions by 5 users not shown) | |||
Line 14: | Line 14: | ||
|- valign="top" | |- valign="top" | ||
| [[Image:pmcf123.jpg|100px|thumb|Name: Patrick McFarland]] | | [[Image:pmcf123.jpg|100px|thumb|Name: Patrick McFarland]] | ||
| [[Image: | | [[Image:micro.png|100px|thumb|Tameem Jamal]] | ||
| [[Image:tolvey.jpg|100px|thumb|Name: Taylor Olvey]] | | [[Image:tolvey.jpg|100px|thumb|Name: Taylor Olvey]] | ||
| [[Image: | | [[Image:Rugby.png|100px|thumb|Name: Zac Roy]] | ||
| [[Image: | | [[Image:Dfghj.jpg|100px|thumb|Name: Alex Berghorst]] | ||
|} | |} | ||
Line 31: | Line 31: | ||
'''TinkerCAD'''<br> | '''TinkerCAD'''<br> | ||
'' | ''TinkerCAD is a free online application that can be accessed through a online account. TinkerCAD is used to design different structures and display them on a screen, which can be modified to the users liking. TinkerCAD also allows you to save your designs and 3D print them through a certain software. TinkerCAD was used to redesign the micro tubes; the tubes were labeled and given different colors (red,blue) to help differentiate between each tubes content. ''<br> | ||
''[ | ''[[Image:Micro Tubes.png]]'' | ||
'''Implications of Using TinkerCAD for Design'''<br> | '''Implications of Using TinkerCAD for Design'''<br> | ||
'' | ''There are many different application of TinkerCAD, including designing new bronchi to replace a misfunctional bronchi. Recently a young baby's bronchus collapsed and prevented him from proper breathing. The doctors stated that the child might not make it out of the hospital. However, Glenn Green M.D and Scott Hollister Ph.D. were able to design a 3D image of the bronchi and 3D print it. Now the child is alive and healthy. TinkerCAD could be used to design the plastic matrices of tissues and be inserted in vivo to allow the growth of cells around it.''<br> | ||
Line 45: | Line 45: | ||
==Feature 1: Cancer SNP-Specific Primers== | ==Feature 1: Cancer SNP-Specific Primers== | ||
'''Background on the cancer-associated mutation'''<br> | '''Background on the cancer-associated mutation'''<br> | ||
Single Nucleotide Polymoprhisms, or SNPs are mutations within DNA that cause a single nucleotide, such as A, T, C, or G, to change to a different nucleotide. This in turn, can cause either a benign alteration, genetic disease, or cancer. In the case of rs17879961, which occurs on human chromosome number 22, cancer is potentially occured. This type of cancer is caused by an interaction with Checkpoint Kinase 2, which in turn halts cell cycle progression because of interacting cell cycle regulators.<br><br> | |||
Line 56: | Line 53: | ||
'''Primer design'''<br> | '''Primer design'''<br> | ||
* Forward Primer: ' | * Forward Primer: <b>5'</b> - ATTTATCTGTTCTTTTCAGC<br> | ||
* Cancer-specific Reverse Primer: ' | * Cancer-specific Reverse Primer: <b>5'</b> - TTGCATACATAGAAGATCA<br> | ||
How the primers work: | How the primers work: The primers work by going all the way up to the "C" nucleotide, which is the cancer causing SNP on the left side, and then goes up to the "C" nucleotide on the other side. If the nucleotide was supposed to be "T", (which is the non cancer nuecleotide) it causes one the primers to not stick and would not copy the sequence through PCR.<br><br> | ||
Line 67: | Line 64: | ||
==Feature 2: Consumables Kit== | ==Feature 2: Consumables Kit== | ||
The materials would be placed inside a covered cardboard box that would be roughly 18” x 10” x 12” in dimension. Each piece would have a specific mold in a block of Styrofoam for protection. The PCR device itself would not need a container since its Styrofoam hole would be enough to protect it. The other tools and materials would be stored in their own cubical containers, which would be placed in molds made of Styrofoam to keep them in place and to prevent damage. The kit will hold two boxes of 56 micro pipette tips, which would be enough for two PCR tests with some tips to spare. A micro pipette and an extra one just in case it becomes damaged. Thirty-two test tubes and a rack that can hold all of the given tubes. Then the PCR machine its self is provided. | |||
Changes will be done to the test tubes that hold the DNA. Other materials are for PCR since our group encountered a problem when we would temporarily lost a certain mixture or solution in our test tubes. We added numbers to the tubes so they can be quickly identified thanks to the number labels on their side. | |||
==Feature 3: PCR Machine Hardware== | |||
The PCR machine is an integral part of this entire operation. The current model used in class, the PCR machine would remain autonomous from the other materials. The current design did have some flaws that will be addressed, however certain design parameters will remain the same. Some examples include the size and portability of the PCR machine. This utilizes a convenient and easy way to maneuver the design, while still having the power to produce results. With the basic size and layout is the same, the main design issues reside in the functionality of the machine. This makes the machine cumbersome to use. Some of the ideas proposed include the addition of separate labeled sections, within the machine that allows for easy differentiation between samples and organization. The second major improvement would be the addition of a processor of sorts, like that on a computer. This would eliminate the need for an outside processing center and additional software that keeps the PCR machine in one concise unit. Finally, although this was not observed with the PCR machine used, it was noted that the PCR machines holistically were rather unreliable, and had a tendency to break and not function properly. In order to address this problem, it is proposed that the new PCR machine utilize more durable materials, eliminating the wooden exterior, as well as fortifying the inner components. | |||
Line 86: | Line 80: | ||
==Feature 4: Fluorimeter Hardware== | ==Feature 4: Fluorimeter Hardware== | ||
The Fluorimeter is used to measure the concentration of the desired DNA. After the samples have been processed through the PCR machine, the SYBR Green is added to the solutions to allow the sample to fluorescent in blue fluorescent light. Then 80µL of the sample is put on the slide, and the slide is inserted into the Fluorimeter. The main components of the Fluorimeter include: a dark chamber to prevent any light into the chamber, a blue LED and a stand to allow the phone to stand on. Setting the camera at 4 cm away from the sample, two images are taken. Now the images are analyzed through Image J to analyze the intensity of the green fluorescent, which indicates the concentration DNA. This method can be used to check for the presence of the desired gene. | |||
<!-- Note: Be sure to delete the text in brackets: ''[ ]'' --> | <!-- Note: Be sure to delete the text in brackets: ''[ ]'' --> |
Latest revision as of 13:38, 27 November 2013
BME 100 Fall 2013 | Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help | |||||
OUR COMPANYJESU Products Group Inc
LAB 6 WRITE-UPComputer-Aided DesignTinkerCAD TinkerCAD is a free online application that can be accessed through a online account. TinkerCAD is used to design different structures and display them on a screen, which can be modified to the users liking. TinkerCAD also allows you to save your designs and 3D print them through a certain software. TinkerCAD was used to redesign the micro tubes; the tubes were labeled and given different colors (red,blue) to help differentiate between each tubes content.
There are many different application of TinkerCAD, including designing new bronchi to replace a misfunctional bronchi. Recently a young baby's bronchus collapsed and prevented him from proper breathing. The doctors stated that the child might not make it out of the hospital. However, Glenn Green M.D and Scott Hollister Ph.D. were able to design a 3D image of the bronchi and 3D print it. Now the child is alive and healthy. TinkerCAD could be used to design the plastic matrices of tissues and be inserted in vivo to allow the growth of cells around it.
Feature 1: Cancer SNP-Specific PrimersBackground on the cancer-associated mutation
Primer design
How the primers work: The primers work by going all the way up to the "C" nucleotide, which is the cancer causing SNP on the left side, and then goes up to the "C" nucleotide on the other side. If the nucleotide was supposed to be "T", (which is the non cancer nuecleotide) it causes one the primers to not stick and would not copy the sequence through PCR.
Feature 2: Consumables KitThe materials would be placed inside a covered cardboard box that would be roughly 18” x 10” x 12” in dimension. Each piece would have a specific mold in a block of Styrofoam for protection. The PCR device itself would not need a container since its Styrofoam hole would be enough to protect it. The other tools and materials would be stored in their own cubical containers, which would be placed in molds made of Styrofoam to keep them in place and to prevent damage. The kit will hold two boxes of 56 micro pipette tips, which would be enough for two PCR tests with some tips to spare. A micro pipette and an extra one just in case it becomes damaged. Thirty-two test tubes and a rack that can hold all of the given tubes. Then the PCR machine its self is provided. Changes will be done to the test tubes that hold the DNA. Other materials are for PCR since our group encountered a problem when we would temporarily lost a certain mixture or solution in our test tubes. We added numbers to the tubes so they can be quickly identified thanks to the number labels on their side. Feature 3: PCR Machine HardwareThe PCR machine is an integral part of this entire operation. The current model used in class, the PCR machine would remain autonomous from the other materials. The current design did have some flaws that will be addressed, however certain design parameters will remain the same. Some examples include the size and portability of the PCR machine. This utilizes a convenient and easy way to maneuver the design, while still having the power to produce results. With the basic size and layout is the same, the main design issues reside in the functionality of the machine. This makes the machine cumbersome to use. Some of the ideas proposed include the addition of separate labeled sections, within the machine that allows for easy differentiation between samples and organization. The second major improvement would be the addition of a processor of sorts, like that on a computer. This would eliminate the need for an outside processing center and additional software that keeps the PCR machine in one concise unit. Finally, although this was not observed with the PCR machine used, it was noted that the PCR machines holistically were rather unreliable, and had a tendency to break and not function properly. In order to address this problem, it is proposed that the new PCR machine utilize more durable materials, eliminating the wooden exterior, as well as fortifying the inner components.
Feature 4: Fluorimeter HardwareThe Fluorimeter is used to measure the concentration of the desired DNA. After the samples have been processed through the PCR machine, the SYBR Green is added to the solutions to allow the sample to fluorescent in blue fluorescent light. Then 80µL of the sample is put on the slide, and the slide is inserted into the Fluorimeter. The main components of the Fluorimeter include: a dark chamber to prevent any light into the chamber, a blue LED and a stand to allow the phone to stand on. Setting the camera at 4 cm away from the sample, two images are taken. Now the images are analyzed through Image J to analyze the intensity of the green fluorescent, which indicates the concentration DNA. This method can be used to check for the presence of the desired gene.
Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach[Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of CHEK2 PCR for predicting cancer. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via e-mail. We are doing so for the sake of academic integrity and to curb any temptation to cheat.] |