BME100 f2013:W1200 Group15 L6

BME 100 Fall 2013	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Name: Patrick McFarland Tameem Jamal Name: Taylor Olvey Name: Zac Roy Name: Alex Berghorst JESU Products Group Inc LAB 6 WRITE-UP Computer-Aided Design TinkerCAD TinkerCAD is a free online application that can be accessed through a online account. TinkerCAD is used to design different structures and display them on a screen, which can be modified to the users liking. TinkerCAD also allows you to save your designs and 3D print them through a certain software. TinkerCAD was used to redesign the micro tubes; the tubes were labeled and given different colors (red,blue) to help differentiate between each tubes content. Implications of Using TinkerCAD for Design There are many different application of TinkerCAD, including designing new bronchi to replace a misfunctional bronchi. Recently a young baby's bronchus collapsed and prevented him from proper breathing. The doctors said that the child might not make it out of the hospital. However Glenn Green, M.D and Scott Hollister, Ph.D. were able to design a 3D image of the bronchi and 3D print it, and now the child is alive. TinkerCAD could be used to design the plastic matrices of tissues and be inserted in vivo to allow the growth of cells around it. Feature 1: Cancer SNP-Specific Primers Background on the cancer-associated mutation Single Nucleotide Polymoprhisms, or SNPs are mutations within DNA that cause a single nucleotide, such as A, T, C, or G, to change to a different nucleotide. This in turn, can cause either a benign alteration, genetic disease, or cancer. In the case of rs17879961, which occurs on human chromosome number 22, cancer is caused. This type of cancer is caused by an interaction with Checkpoint Kinase 2, which in turn halts cell cycle progression because of interacting cell cycle regulators. Primer design Forward Primer: 5' - ATTTATCTGTTCTTTTCAGC Cancer-specific Reverse Primer: 5' - TTGCATACATAGAAGATCA How the primers work: The primers work by going all the way up to the "C" nucleotide, which is the cancer causing SNP on the left side and going up to the "C" nucleotide on the other side. If the nucleotide were to be "T", which is the non cancer causing one the primers would not stick and would not copy the sequence through PCR. Feature 2: Consumables Kit The materials would be placed inside a cardboard box that would be roughly 18” x 10” x 12” in dimension. Each piece would have a specific mold in a block of Styrofoam for protection. The PCR device itself would not need a container since its Styrofoam hole would be enough to protect it. The other tools and materials would be stored in their own cubical containers which would be placed in molds made of Styrofoam to keep them in place and to prevent damage. The kit will hold two boxes of 56 micro pipette tips, which would be enough for two PCR tests with some tips to spare, along with a micro pipette and one extra in case one becomes damaged. Thirty-two test tubes and a rack that can hold all of the given tubes. Then the PCR machine its self is provided. Changes will be done to the test tubes that hold the DNA and other materials for PCR since our group encountered a problem when we would temporarily lose take of which tube held a certain mixture or solution. So we added numbers to the tubes so they can be quickly identified thanks to the number labels on their side. Feature 3: PCR Machine Hardware The PCR machine is an integral part of this entire operation. Like the current model used in class, the PCR machine would remain autonomous from the other materials. The current design does have some flaws that will be addressed, however certain design parameters will remain the same. Some examples include the size and portability of the PCR machine, which utilizes a convenient easy to maneuver design, while still having the power to produce results. With the basic size and layout the same, the main design issues reside in the functionality of the machine, which make the machine cumbersome to use. Some of the ideas proposed, include the addition of separate, labeled sections within the machine that allows for easy differentiation between samples and organization. The second major improvement would be the addition of a processor of sorts, like that on a computer. This would eliminate the need for an outside processing center and additional software, and keep the PCR machine in one concise unit. Finally, although this was not observed with the PCR machine used, it was noted that the PCR machines holistically were rather unreliable, and had a tendency to break and not function properly. In order to address this problem, it is proposed that the new PCR machine utilize more durable materials, eliminating the wooden exterior, as well as fortifying the inner components. Feature 4: Fluorimeter Hardware The Fluorimeter is used to measure the concentration of the desired DNA. After the samples have been processed through the PCR machine, the SYBR Green is added to the solutions to allow the sample to fluorescent in blue light. Then 80µL of the sample is put on the slide, and the slide is inserted into the Fluorimeter. The main components of the Fluorimeter include: a dark chamber to prevent any light into the chamber, a blue LED and a stand to allow the phone to stand on. Setting the camera at 4 cm away from the sample, two images are taken. Now the images are analyzed through Image J to analyze the intensity of the green fluorescent, which indicates the concentration DNA. This method can be used to check for the presence of the desired gene. Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach [Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of CHEK2 PCR for predicting cancer. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via e-mail. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]