BME100 f2013:W1200 Group15 L6

BME 100 Fall 2013	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Name: Patrick McFarland Tameem Jamal Name: Taylor Olvey Name: student Name: student JESU Products Group Inc LAB 6 WRITE-UP Computer-Aided Design TinkerCAD TinkerCAD is a free online application that can be accessed through a online account. TinkerCAD is used to design different structures and display them on a screen. TinkerCAD also allows you to save your designs and 3D print them through a certain software. TinkerCAD was used to redesign the micro tubes; the tubes were labeled and given different colors (red,blue) to help differentiate between each tubes content. Implications of Using TinkerCAD for Design There are many different application of TinkerCAD, including designing new bronchi to replace a misfunctional bronchi. Recently a young baby's bronchus collapsed and prevented him from proper breathing. The doctors said that the child might not make it out of the hospital. However Glenn Green, M.D and Scott Hollister, Ph.D. were able to design a 3D image of the bronchi and 3D print it, and now the child is alive. TinkerCAD could be used to design the plastic matrices of tissues and be inserted in vivo to allow the growth of cells around it. Feature 1: Cancer SNP-Specific Primers Background on the cancer-associated mutation Single Nucleotide Polymoprhisms, or SNPs are mutations within DNA that cause a single nucleotide, such as A, T, C, or G, to change to a different nucleotide. This in turn, can cause either a benign alteration, genetic disease, or cancer. In the case of rs17879961, which occurs on human chromosome number 22, cancer is caused. This type of cancer is caused by an interaction with Checkpoint Kinase 2, which in turn halts cell cycle progression because of interacting cell cycle regulators. Primer design Forward Primer: 5' - ATTTATCTGTTCTTTTCAGC Cancer-specific Reverse Primer: 5' - TTGCATACATAGAAGATCA How the primers work: The primers work by going all the way up to the "C" nucleotide, which is the cancer causing SNP on the left side and going up to the "C" nucleotide on the other side. If the nucleotide were to be "T", which is the non cancer causing one the primers would not stick and would not copy the sequence through PCR. Feature 2: Consumables Kit [Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.] [Instructions: IF your consumables packaging plan addresses any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] The materials would be placed inside a cardboard box that would be roughly 18” x 10” x 12” in dimension. Each piece would have a specific mold in a block of Styrofoam for protection. The PCR device itself would not need a container since its Styrofoam hole would be enough to protect it. The other tools and materials would be stored in their own cubical containers which would be placed in molds made of Styrofoam to keep them in place and to prevent damage. Changes will be done to the test tubes that hold the DNA and other materials for PCR since our group encountered a problem when we would temporarily lose take of which tube held a certain mixture or solution. So we added numbers to the tubes so they can be quickly identified thanks to the number label on its side. Feature 3: PCR Machine Hardware [Instructions: Summarize how you will include the PCR machine in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.] [Instructions: IF your group has decided to redesign the PCR machine to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Feature 4: Fluorimeter Hardware The Fluorimeter is used to measure the concentration of the desired DNA. After the samples have been processed through the PCR machine, the SYBR Green is added to the solutions to allow the sample to fluorescent in blue light. Then 80µL of the sample is put on the slide, and the slide is inserted into the Fluorimeter. The main components of the Fluorimeter include: a dark chamber to prevent any light into the chamber, a blue LED and a stand to allow the phone to stand on. Setting the camera at 4 cm away from the sample, two images are taken. Now the images are analyzed through Image J to analyze the intensity of the green fluorescent, which indicates the concentration DNA. This method can be used to check for the presence of the desired gene." Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach [Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of CHEK2 PCR for predicting cancer. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via e-mail. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]