BME100 f2013:W1200 Group15 L6

BME 100 Fall 2013	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Name: Patrick McFarland Tameem Jamal Name: Taylor Olvey Name: student Name: student JESU Products Group Inc LAB 6 WRITE-UP Computer-Aided Design TinkerCAD [Instructions: A short summary (up to five sentences) of the TinkerCAD tool and how you used it in lab on November 20th] Implications of Using TinkerCAD for Design [Instructions: A short paragraph discussing just one possible way to use TinkerCAD for something practical...like redesigning the OpenPCR machine, fluorimeter, camera holder, printing out some of the smaller plastic items on demand, etc. There are lots of possibilities...pick just ONE.] Feature 1: Cancer SNP-Specific Primers Background on the cancer-associated mutation Single Nucleotide Polymoprhisms, or SNPs are mutations within DNA that cause a single nucleotide, such as A, T, C, or G, to change to a different nucleotide. This in turn, can cause either a benign alteration, genetic disease, or cancer. In the case of rs17879961, which occurs on human chromosome number 22, cancer is caused. This type of cancer is caused by an interaction with Checkpoint Kinase 2, which in turn halts cell cycle progression because of interacting cell cycle regulators. Primer design Forward Primer: 5' - ATTTATCTGTTCTTTTCAGC Cancer-specific Reverse Primer: 5' - TTGCATACATAGAAGATCA How the primers work: The primers work by going all the way up to the "C" nucleotide, which is the cancer causing SNP on the left side and going up to the "C" nucleotide on the other side. If the nucleotide were to be "T", which is the non cancer causing one the primers would not stick and would not copy the sequence through PCR. Feature 2: Consumables Kit [Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.] [Instructions: IF your consumables packaging plan addresses any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Feature 3: PCR Machine Hardware [Instructions: Summarize how you will include the PCR machine in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.] [Instructions: IF your group has decided to redesign the PCR machine to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Feature 4: Fluorimeter Hardware [Instructions: Summarize how you will include the fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really REALLY awesome and easy to score.] [Instructions: IF your group has decided to redesign the fluorimeter to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach [Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of CHEK2 PCR for predicting cancer. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via e-mail. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]