BME100 f2013:W1200 Group14 L6

BME 100 Fall 2013	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Name: Minh Pham Name: Brianna Schilling Name: Ashley Powell Name: Hannah Brutsche Name: Vaasavi Sundar LAB 6 WRITE-UP Computer-Aided Design TinkerCAD The TinkerCAD is a 3D modeling program that has the ability to form and mold into any product. With this program, one can quickly design and print a 3D product. We used this program's simple shapes to construct improvements. We were provided PCR tubes and with the tinker tools, we redesigned it and changed many aspects. We decided to add connectors between the individual tubes, color coding, and strips where one could write on to improve organization. Implications of Using TinkerCAD for Design With the use of tinkercad, an OpenPCR machine can be improved drastically. If a piece was damaged, one could quickly be made to the correct specifications using any material. 3D printers do not only print plastic, they can print objects using various hard substances. The tinkercad program can recreate the internals and outer casing of the PCR machine. It currently cannot make circuit boards, but can definitely make the PCR tube holder, the lid, circuit board cases, and screws. It would be best not to make the newly designed PCR machine out of plastic because PCR machines can really heat up. Instead of reconstructing a new machine each time and waiting for different parts from different manufacturers, the 3D printer can get almost everything done in one room, which will reduce cost and time. Feature 1: Cancer SNP-Specific Primers Background on the cancer-associated mutation This lab focused on cancer-SNP's. The building blocks of DNA are called nucleotides, which are basically the subunits of the nucleic acids that make up DNA. Within a DNA sequence, there can by polymorphisms, which are variances in the DNA sequence. This SNP in particular is found in the DNA of homo sapiens, or humans. This SNP is pathogenic. There is a total of 23 pairs of chromosomes in the human genome-- this SNP occurs on the 22nd chromosome. rs17879961 affects a gene which contains the gene CHEK2, which stands for checkpoint kinase 2. The purpose of this gene is to regulate the cell cycle, and to suppress the growth of tumors. Primer design Forward Primer: 5' - TGTAAGGACAGGACAAATTT Cancer-specific Reverse Primer: 5' - TGGGTCCTAAAAACTCTTAC How the primers work: Primers are specific to the cancer-specific because there are both forward and reverse primers, which limit the sequence that can be created. For example, because the forward primer signals the beginning of the replication process, and the reverse primer signals the end of the replication, so the part that is replicated is limited to the DNA that is between the sequence of the forward and the reverse primer. The forward primer binds to the complementary cancer SNP template DNA, as does the reverse primer-- once this has happened, DNA polymerase binds to the template DNA strand and begins to synthesize the complementary strand. Without the primers, DNA polymerase cannot bind to the template DNA, so only the segments with the proper primers are replicated. Therefore, if the DNA strand does not contain the cancer SNP segment, it will not be replicated because the primers will not attach and the DNA polymerase will not bind to the template strand. Feature 2: Consumables Kit We will package the consumables in styrofoam to prevent damage of the materials during transportation of the kit and to make identifying and repackaging of the materials simple for the consumer. Each part of the kit will be neatly labeled and arranged in a way that is intuitive for people looking to use the system but also efficient and space effective. All parts of the kit will packaged in a single box with information on each part of the kit. The box will clearly label it's content and will have our logo. Our target audience is anyone looking for a simple, intuitive way to analyze DNA sequences. The reagent bottles will be clearly labeled and color coded so there is no confusion for anyone trying to use the kit. We will include an easy disposal container for pipette tips with a narrow opening to prevent any spills that could happen with a disposal container found at home (such as a plastic cup). Our group determined that the pipet tips could be packaged more efficiently if they were stacked on top of each other rather than just in a single plastic case per layer of tips. This will make them easier to access because they easily stack without getting stuck together. in order to prevent them from being easy to spill, they will be enclosed in a plastic container with a spring base to push the layers to the top as tips are used. We determined in the kit that we used that the SYBR Green container let in too much light and was deactivated quickly if not crudely covered in our groups. To prevent this, we propose that we use solid dark colored plastic for the containers to prevent the light from reaching the dye when the container is closed. We will also clearly state in our instruction manual that the dye needs to be handled with care to prevent the light from reaching the dye. Feature 3: PCR Machine Hardware The PCR machine from the lab itself will be included in this PCR kit. However, we will make a few changes-- for example, one of the primary weaknesses of the PCR machine was that there was it took a long time for a small sample. This will be changed in this particular kit because there will be more slots for a greater number of tubes, so that there can be a greater amount of DNA that can be replicated in one cycle. Our group has found that the PCR machine has several major weaknesses. One of which was already mentioned, the amount of time that one sample takes to run to completion. This could be fixed by adding more spaces for PCR tubes. Adding more PCR tubes would allow the machine to create the same amount of DNA in less time, therefore reducing the need to wait hours for a small amount of DNA to be produced. Another weakness was that the wooden exterior of the machine is not the best casing. The wood is flimsy, and when you attempt to take the machine apart, it nearly splinters from trying to put it back in place. The wood only allows screws to stay in place if a nut is holding in place; however, the wood doesn't properly hold the nut all the time, causing the machine to not be properly held together. This all could be fixed by changing the casing of the machine to a material that is not a good heat or electricity conductor, but is sturdy. And finally, the heating and cooling system could be more efficient. If this were to be improved, it would help to speed up the reaction and therefore decrease waiting time. Feature 4: Fluorimeter Hardware The fluorimeter will be packaged with the light box being collapsible to allow for easy transport, and all the camera equipment placed on top of it. These will be the last items in the boxed PCR kit that we are creating. Our group identified the fact that it is difficult to get uniform photos for each trial. We would fix this by including a holder for a camera that attaches to the fluorimeter itself to prevent the distance between the camera and the drop from changing. This holder will be height and horizontally adjustable so that the user can find the best angle for the photo and be consistent with it every time. Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach [Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of CHEK2 PCR for predicting cancer. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via e-mail. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]