BME100 f2013:W1200 Group14 L6

BME 100 Fall 2013	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Name: Minh Pham Name: student Name: student Name: student Name: student Name: student [Instructions: add the name of your team's company and/or product here] LAB 6 WRITE-UP Computer-Aided Design TinkerCAD The TinkerCAD is a 3D modeling program that has the ability to form and mold into any product. With this program, one can quickly design and print a 3D product. We used this program's simple shapes to construct improvements. We were provided PCR tubes and with the tinker tools, we redesigned it and changed many aspects. We decided to add connectors between the individual tubes, color coding, and strips where one cold right on to improve organization. Implications of Using TinkerCAD for Design With the use of tinkercad, an OpenPCR machine can be improved drastically. If a piece was damaged, one could quickly be made to the correct specifications using any material. 3D printers do not only print plastic, they can print objects using various hard substances. The tinkercad program can recreate the internals and outer casing of the PCR machine. It currently cannot make circuit boards, but can definitely make the PCR tube holder, the lid, circuit board cases, and screws. It would be best not to make the newly designed PCR machine out of plastic because PCR machines can really heat up. Instead of reconstructing a new machine each time and waiting for different manufacturers, the 3D printer can mostly everything done in one room, which will reduce cost and time. Feature 1: Cancer SNP-Specific Primers [Instructions: This information will come from the Week 9 exercises you did in lab. Your notes should be in a pdf file that is saved on Blackboard under your group.] Background on the cancer-associated mutation [Instructions: Use the answers from questions 3, 4, 5, and 7 to compose, in your own words, a paragraph about rs17879961] This lab focused on cancer-SNP's. The building blocks of DNA are called nucleotides, which are basically the subunits of the nucleic acids that make up DNA. Within a DNA sequence, there can by polymorphisms, which are variances in the DNA sequence. This SNP in particular is found in the DNA of homo sapiens, or humans. This SNP is pathogenic. There is a total of 23 pairs of chromosomes in the human genome-- this SNP occurs on the 22nd chromosome. rs17879961 affects a gene which contains the gene CHEK2, which stands for checkpoint kinase 2. The purpose of this gene is to regulate the cell cycle, and to suppress the growth of tumors. Primer design Forward Primer: [Instructions: write the sequence of the forward primer] 5' AAGGACAGGACAAATTTTCC Cancer-specific Reverse Primer: [Instructions: write the sequence of the forward primer] 5' GTTACATTCTCAAAATCC How the primers work: [Instructions: explain what makes the primers cancer-sequence specific. In other words, explain why the primers will amplify DNA that contains the cancer-associated SNP rs17879961, and will not exponentially amplify DNA that has the non-cancer allele.] Feature 2: Consumables Kit [Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.] [Instructions: IF your consumables packaging plan addresses any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Feature 3: PCR Machine Hardware [Instructions: Summarize how you will include the PCR machine in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.] [Instructions: IF your group has decided to redesign the PCR machine to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Feature 4: Fluorimeter Hardware [Instructions: Summarize how you will include the fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really REALLY awesome and easy to score.] [Instructions: IF your group has decided to redesign the fluorimeter to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach [Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of CHEK2 PCR for predicting cancer. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via e-mail. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]