BME100 f2013:W1200 Group13 L6

BME 100 Fall 2013	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Name: Samantha Brenna Name: Briana Ybarra Name: Scott Ashmore Name: Brenda Vargas Name: Joseph Salerno [Instructions: add the name of your team's company and/or product here] LAB 6 WRITE-UP Computer-Aided Design TinkerCAD Our group used TinkerCAD to create new PCR tubes. The design of the tubes was created while considering organization and ease of handling. The openPCR machine that we used in class is set up to hold four rows of four. We set up our tubes to be in two groups, Each group connected for handling and organization. The first group is the + control and the three trials of patient 1, thus our tubes are labeled so "+" "1-1" "1-2" "1-3" are visible and have a slight grade so they can be felt as well without getting stuck in the machine. The same was done for the second group of tubes with the - control and patient2's trials respectively. Implications of Using TinkerCAD for Design [Instructions: A short paragraph discussing just one possible way to use TinkerCAD for something practical...like redesigning the OpenPCR machine, fluorimeter, camera holder, printing out some of the smaller plastic items on demand, etc. There are lots of possibilities...pick just ONE.] Feature 1: Cancer SNP-Specific Primers [Instructions: This information will come from the Week 9 exercises you did in lab. Your notes should be in a pdf file that is saved on Blackboard under your group.] Background on the cancer-associated mutation A nucleotide is the functional unit (monomer) that is a basic component of DNA and RNA molecules. A polymorphism is a common variation in a DNA sequence. The variation rs17879961 is found in the Homo Sapiens species. The clinical significance of this SNP with the pathogenic allele is that it modifies CHEK2. CHEK2 stands for checkpoint kinase 2 which stops the cell from going into mitosis if the DNA is damaged. Typically humans have 23 chromosomes and the SNP of this variation is found on chromosome 22. [Instructions: Use the answers from questions 3, 4, 5, and 7 to compose, in your own words, a paragraph about rs17879961] Primer design Forward Primer: 5'-ACTCACTTAAACCATATTCT Cancer-specific Reverse Primer: 5'- GGTCCTAAAAACTCTTACAC How the primers work: [Instructions: explain what makes the primers cancer-sequence specific. In other words, explain why the primers will amplify DNA that contains the cancer-associated SNP rs17879961, and will not exponentially amplify DNA that has the non-cancer allele.] Feature 2: Consumables Kit [Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.] [Instructions: IF your consumables packaging plan addresses any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Feature 3: PCR Machine Hardware [Instructions: Summarize how you will include the PCR machine in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.] [Instructions: IF your group has decided to redesign the PCR machine to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Feature 4: Fluorimeter Hardware [Instructions: Summarize how you will include the fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really REALLY awesome and easy to score.] [Instructions: IF your group has decided to redesign the fluorimeter to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Redesign of Fluorimeter: The Fluorimeter would be redesigned to decrease the opportunity for error. One aspect of the design would be connecting the actual Fluorimeter with the slide holder to the camera phone holder. This would be an adjustable sliding platform with a ruler in order to record how far it is from the drop and then moving the machine wouldn't affect the experiment. Another portion of the redesign includes connecting this sliding platform of the Fluorimeter to another sliding platform under the black box. This would allow one to take the pictures with blocking more light making the experiment more accurate. Having all of the parts of the device connected and adjustable makes the experiment more accurate because there can be more aspects constant. Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach [Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of CHEK2 PCR for predicting cancer. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via e-mail. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]