BME100 f2013:W1200 Group10 L6

BME 100 Fall 2013	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Name: Robert Childers Name: Daniel Palmer Name: Akshara Malla Name: Jordan Jones Name: Ryan Hearn Name: student Helix Detection LAB 6 WRITE-UP Computer-Aided Design TinkerCAD TinkerCAD is an online program accessed at Tinkercad.com. It is a free to use program for creating 3D models online. With a variety of tools and templates, it is easy to create a 3D model and save the file in multiple different formats for 3D printing and other applications. In our lab we used it to improve on a PCR tube design by creating a tray set for the tubes that is properly labeled and easy to work with. Implications of Using TinkerCAD for Design [Instructions: A short paragraph discussing just one possible way to use TinkerCAD for something practical...like redesigning the OpenPCR machine, fluorimeter, camera holder, printing out some of the smaller plastic items on demand, etc. There are lots of possibilities...pick just ONE.] Feature 1: Cancer SNP-Specific Primers Background on the cancer-associated mutation rs17879961 is a polymorphism of a single nucleotide on the 22nd chromosome in humans. This polymorphism is found in the CHEK2 gene which regulates teh cell cylce. The presence of this allele results in an increased risk of breast cancer. Primer design Forward Primer: CTCAAAAATCCTGGGTGAAG Cancer-specific Reverse Primer: GAAGTGGGTCCTAAAAACTC How the primers work: The primer bonds with ssDNA at the matching base pairs in the sequence. This provides a place for the taq polymerase to bond and initiate extension of the primer. Feature 2: Consumables Kit [Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.] [Instructions: IF your consumables packaging plan addresses any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Feature 3: PCR Machine Hardware A PCR machine will be included in our new diagnostic testing system. The PCR machine is used to replicate double stranded DNA. The machine will copy and produce many copies of a certain strand or segment of DNA. By examining the certain parts of DNA, the results are then able to be analyzed to detect and diagnose diseases. Some parts of the machine in the new testing system will stay the same and some will be improved. One aspect that will be changed in the size of the PCR machine. If the size of the tray is increased then more samples will be able to be ran at once. The screen that is directly on the machine is a positive aspect. The new testing system will allow users to program the device using either the software program on the computer or by directly programming on the device. Feature 4: Fluorimeter Hardware A fluorimeter serves as a device that measures fluorescence by recording the intensity and wavelength of light that passes through a sample with fluorescent dye. The fluorimeter is composed of the fluorimeter device, a marked glass slide, a box to cover the device, and a smartphone holder. An 80 microliter drop of the green dye is placed in the middle of two circles on the hydrophobic side of the glass slide once the slide is placed in the device. An 80 microliter drop of the sample solution is placed on top of the dye. The slide must be placed so that the beam of light passes through the drop. The stand holding the smartphone must be placed less than 4 cm away from the device. Once a box covers the entire device, a picture is taken. The image taken by the camera can then be analyzed on the computer using the Image J software. The fluorimeter did not pose any major obstacles. The fluorimeter will be used largely in the same way as before except with a few modifications. Although a strength of the fluorimeter was the inclusion of marked glass slides, the device can be improved. The fluorimeter will be redesigned to include a camera that will be built in and attached to the other components of the device. Although the phone cameras were easy to use, the quality of the images can be variable across the different brands and models of the phones used. Therefore, a camera specifically chosen for the device ensures that the quality of the image is high. Additionally, the distance from the camera stand and the device can change and move from the 4 cm mark during the experiment. In order to keep all variables constant, the smartphone stand will be attached to the rest of the device. These improvements ensure that a limited number of variables can affect the outcome of the images that will be analyzed on the computer. Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach [Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of CHEK2 PCR for predicting cancer. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via e-mail. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]