BME100 f2013:W1200 Group10 L6

BME 100 Fall 2013	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Name: Robert Childers Name: Daniel Palmer Name: Akshara Malla Name: Jordan Jones Name: Ryan Hearn Name: student Helix Detection LAB 6 WRITE-UP Computer-Aided Design TinkerCAD TinkerCAD is an online program accessed at Tinkercad.com. It is a free to use program for creating 3D models online. With a variety of tools and templates, it is easy to create a 3D model and save the file in multiple different formats for 3D printing and other applications. In our lab we used it to improve on a PCR tube design by creating a tray set for the tubes that is properly labeled and easy to work with. Implications of Using TinkerCAD for Design TinkerCAD could be used to improve the PCR lab procedure by improving the quality of use of the camera holder. For example, the camera holder could have various sized indents where the phone rests in order for the base of the phone to fit snugly and prevent extra movement. Also, the angle at which the camera is held could be made adjustable, so the angle at which the picture is taken can always be consistent. The holder itself could also be improved to have a base designed to prevent sliding of the holder, in order to ensure the distance is always the same for each photograph. These changes would minimize error as well as make the system easier to use. Feature 1: Cancer SNP-Specific Primers Background on the cancer-associated mutation rs17879961 is a polymorphism of a single nucleotide on the 22nd chromosome in humans. This polymorphism is found in the CHEK2 gene which regulates teh cell cylce. The presence of this allele results in an increased risk of breast cancer. Primer design Forward Primer: CTCAAAAATCCTGGGTGAAG Cancer-specific Reverse Primer: GAAGTGGGTCCTAAAAACTC How the primers work: The primer bonds with ssDNA at the matching base pairs in the sequence. This provides a place for the taq polymerase to bond and initiate extension of the primer. Feature 2: Consumables Kit In the Helix Detection PCR Kit, there are all the materials necessary to perform PRC reactions. It contains PCR mix, primers, phone stand, pipette trays, PCR tubes, tube holders, and a box to keep it all in. With each component of the kit, it is packaged specifically so the user has the least amount of trouble with the products. The pipette trays are stackable and interlocked while stacked, allowing many of them to be organized together without taking up a lot of room and allowing them to be secured while stacked. The PCR tubes are already covered with foil so the substances do not get denatured by the exposure to light so the users do not have to individually wrap each tube, which is tedious. Each other part of the kit is wrapped individually instead of in a big plastic bag to be able to keep everything organized and to be able to store materials that are not used. The phone stand was the biggest problem that all groups came across because of the difficulty of keeping the phone stable for every picture without moving it around. The phone stand in this kit will be adjustable in height and a strap to secure it in place so the phone can have a consistent position with each picture. The efficiency of the pictures will allow for better data results and will keep the PCR reactions moving along smoothly. Most of the components of this kit are made of a strong plastic that can be dropped without it breaking, so the reactions can still go on. Feature 3: PCR Machine Hardware A PCR machine will be included in our new diagnostic testing system. The PCR machine is used to replicate double stranded DNA. The machine will copy and produce many copies of a certain strand or segment of DNA. By examining the certain parts of DNA, the results are then able to be analyzed to detect and diagnose diseases. Some parts of the machine in the new testing system will stay the same and some will be improved. One aspect that will be changed in the size of the PCR machine. If the size of the tray is increased then more samples will be able to be ran at once. The screen that is directly on the machine is a beneficial aspect. The new testing system will allow users to program the device using either the software program on the computer or by directly programming on the device. The time aspect of the PCR machine will also be improved for the new system. The original machine takes two or more hours to perform the reaction. The machine will be more efficient if it works at a higher speed. Feature 4: Fluorimeter Hardware A fluorimeter serves as a device that measures fluorescence by recording the intensity and wavelength of light that passes through a sample with fluorescent dye. The fluorimeter is composed of the fluorimeter device, a marked glass slide, a box to cover the device, and a smartphone holder. An 80 microliter drop of the green dye is placed in the middle of two circles on the hydrophobic side of the glass slide once the slide is placed in the device. An 80 microliter drop of the sample solution is placed on top of the dye. The slide must be placed so that the beam of light passes through the drop. The stand holding the smartphone must be placed less than 4 cm away from the device. Once a box covers the entire device, a picture is taken. The image taken by the camera can then be analyzed on the computer using the Image J software. The fluorimeter did not pose any major obstacles. The fluorimeter will be used largely in the same way as before except with a few modifications. Although a strength of the fluorimeter was the inclusion of marked glass slides, the device can be improved. The fluorimeter will be redesigned to include a camera that will be built in and attached to the other components of the device. Although the phone cameras were easy to use, the quality of the images can be variable across the different brands and models of the phones used. Therefore, a camera specifically chosen for the device ensures that the quality of the image is high. Additionally, the distance from the camera stand and the device can change and move from the 4 cm mark during the experiment. In order to keep all variables constant, the smartphone stand will be attached to the rest of the device. These improvements ensure that a limited number of variables can affect the outcome of the images that will be analyzed on the computer. Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach [Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of CHEK2 PCR for predicting cancer. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via e-mail. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]