BME100 f2013:W1200 Group10 L6: Difference between revisions
Line 58: | Line 58: | ||
'''Primer design'''<br> | '''Primer design'''<br> | ||
* Forward Primer: | * Forward Primer: CTCAAAAATCCTGGGTGAAG | ||
* Cancer-specific Reverse Primer: | * Cancer-specific Reverse Primer: GAAGTGGGTCCTAAAAACTC | ||
How the primers work: | How the primers work: The primer bonds with ssDNA at the matching base pairs in the sequence. This provides a place for the taq polymerase to bond and initiate extension of the primer. | ||
==Feature 2: Consumables Kit== | ==Feature 2: Consumables Kit== |
Revision as of 21:51, 26 November 2013
BME 100 Fall 2013 | Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help | ||||||
OUR COMPANY
LAB 6 WRITE-UPComputer-Aided DesignTinkerCAD [Instructions: A short summary (up to five sentences) of the TinkerCAD tool and how you used it in lab on November 20th] [Instructions: Show an image of your TinkerCAD PCR tube design here]
[Instructions: A short paragraph discussing just one possible way to use TinkerCAD for something practical...like redesigning the OpenPCR machine, fluorimeter, camera holder, printing out some of the smaller plastic items on demand, etc. There are lots of possibilities...pick just ONE.]
Feature 1: Cancer SNP-Specific PrimersBackground on the cancer-associated mutation rs17879961 is a polymorphism of a single nucleotide on the 22nd chromosome in humans. This polymorphism is found in the CHEK2 gene which regulates teh cell cylce. The presence of this allele results in an increased risk of breast cancer.
Primer design
How the primers work: The primer bonds with ssDNA at the matching base pairs in the sequence. This provides a place for the taq polymerase to bond and initiate extension of the primer. Feature 2: Consumables Kit[Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.] [Instructions: IF your consumables packaging plan addresses any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.]
Feature 3: PCR Machine Hardware[Instructions: Summarize how you will include the PCR machine in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.] [Instructions: IF your group has decided to redesign the PCR machine to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.]
Feature 4: Fluorimeter Hardware[Instructions: Summarize how you will include the fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really REALLY awesome and easy to score.] [Instructions: IF your group has decided to redesign the fluorimeter to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.]
Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach[Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of CHEK2 PCR for predicting cancer. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via e-mail. We are doing so for the sake of academic integrity and to curb any temptation to cheat.] |