BISC219/F12: RNAi Lab 7 - Revision history

Tucker Crum: /* Agarose Gel Electrophoresis */

Tucker Crum — Mon, 03 Dec 2012 16:04:48 GMT

Agarose Gel Electrophoresis

←Older revision		Revision as of 16:04, 3 December 2012
Line 114:		Line 114:
	#Add 5 μL of loading dye to each PCR product. You will find a precast 1% agarose gel with Sybr-Safe in 1x TAE buffer (prepared by our lab specialist) that is just for two groups' use. Make sure that the wells of the gel are closest to the black (negative) electrode and that the gel apparatus has plenty of buffer. Draw a template in your lab notebook so you know which colony is to be put in each lane (1-7 left to right) and which lane contains your DNA ladder. Make sure you get a copy of the DNA ladder key.<BR>		#Add 5 μL of loading dye to each PCR product. You will find a precast 1% agarose gel with Sybr-Safe in 1x TAE buffer (prepared by our lab specialist) that is just for two groups' use. Make sure that the wells of the gel are closest to the black (negative) electrode and that the gel apparatus has plenty of buffer. Draw a template in your lab notebook so you know which colony is to be put in each lane (1-7 left to right) and which lane contains your DNA ladder. Make sure you get a copy of the DNA ladder key.<BR>
	#Load 15μL of each PCR product into separate wells in the gel. Make sure they are loaded in alphabetical order left to right, A, B, C. <BR>		#Load 15μL of each PCR product into separate wells in the gel. Make sure they are loaded in alphabetical order left to right, A, B, C. <BR>
-	#Load 5 μL of the 100 base pair DNA ladder in the well on the far right. Our standards ladder is product number NEB323-2S from New England Biologicals. The manufacturer supplies the following information about ~~this product~~.<BR>	+	#Load 5 μL of the 100 base pair DNA ladder in the well on the far right.
		+	#Run the gel for ~ 20min. at ~120 volts. <BR>
		+	Our standards ladder is product number NEB323-2S from New England Biologicals. The manufacturer supplies the following information about the standards ladder.<BR>
	[[Image:NEB323-S1.jpg]]		[[Image:NEB323-S1.jpg]]
	<BR>		<BR>
-	~~#Run the gel for ~ 20min. at ~120 volts. <BR>~~

	=='''Capturing Digital Images of Nucleic Acid Gels Stained with SYBR Safe Using the BioRad Imaging System in L308''' ==		=='''Capturing Digital Images of Nucleic Acid Gels Stained with SYBR Safe Using the BioRad Imaging System in L308''' ==

Tucker Crum: /* Agarose Gel Electrophoresis */

Tucker Crum — Mon, 03 Dec 2012 16:03:53 GMT

Agarose Gel Electrophoresis

←Older revision		Revision as of 16:03, 3 December 2012
Line 112:		Line 112:
	=='''Agarose Gel Electrophoresis'''==		=='''Agarose Gel Electrophoresis'''==
	After the PCR reactions have, we hope, made millions of copies of ''lsy-2'' you will take a sample of the PCR product and run a gel to analyze the results of the amplification (the search for your gene). <BR>		After the PCR reactions have, we hope, made millions of copies of ''lsy-2'' you will take a sample of the PCR product and run a gel to analyze the results of the amplification (the search for your gene). <BR>
-	#Add 5 μL of loading dye to each PCR product.	+	#Add 5 μL of loading dye to each PCR product. You will find a precast 1% agarose gel with Sybr-Safe in 1x TAE buffer (prepared by our lab specialist) that is just for two groups' use. Make sure that the wells of the gel are closest to the black (negative) electrode and that the gel apparatus has plenty of buffer. Draw a template in your lab notebook so you know which colony is to be put in each lane (1-7 left to right) and which lane contains your DNA ladder. Make sure you get a copy of the DNA ladder key.<BR>
-	You will find a precast 1% agarose gel with Sybr-Safe in 1x TAE buffer (prepared by our lab specialist) that is just for two groups' use. Make sure that the wells of the gel are closest to the black (negative) electrode and that the gel apparatus has plenty of buffer. Draw a template in your lab notebook so you know which colony is to be put in each lane (1-7 left to right) and which lane contains your DNA ladder. Make sure you get a copy of the DNA ladder key.<BR>	+
	#Load 15μL of each PCR product into separate wells in the gel. Make sure they are loaded in alphabetical order left to right, A, B, C. <BR>		#Load 15μL of each PCR product into separate wells in the gel. Make sure they are loaded in alphabetical order left to right, A, B, C. <BR>
	#Load 5 μL of the 100 base pair DNA ladder in the well on the far right. Our standards ladder is product number NEB323-2S from New England Biologicals. The manufacturer supplies the following information about this product.<BR>		#Load 5 μL of the 100 base pair DNA ladder in the well on the far right. Our standards ladder is product number NEB323-2S from New England Biologicals. The manufacturer supplies the following information about this product.<BR>

Tucker Crum: /* Agarose Gel Electrophoresis */

Tucker Crum — Mon, 03 Dec 2012 16:03:40 GMT

Agarose Gel Electrophoresis

←Older revision		Revision as of 16:03, 3 December 2012
Line 112:		Line 112:
	=='''Agarose Gel Electrophoresis'''==		=='''Agarose Gel Electrophoresis'''==
	After the PCR reactions have, we hope, made millions of copies of ''lsy-2'' you will take a sample of the PCR product and run a gel to analyze the results of the amplification (the search for your gene). <BR>		After the PCR reactions have, we hope, made millions of copies of ''lsy-2'' you will take a sample of the PCR product and run a gel to analyze the results of the amplification (the search for your gene). <BR>
-	#Add 5 μL of loading dye to each PCR product.~~<BR>~~	+	#Add 5 μL of loading dye to each PCR product.
	You will find a precast 1% agarose gel with Sybr-Safe in 1x TAE buffer (prepared by our lab specialist) that is just for two groups' use. Make sure that the wells of the gel are closest to the black (negative) electrode and that the gel apparatus has plenty of buffer. Draw a template in your lab notebook so you know which colony is to be put in each lane (1-7 left to right) and which lane contains your DNA ladder. Make sure you get a copy of the DNA ladder key.<BR>		You will find a precast 1% agarose gel with Sybr-Safe in 1x TAE buffer (prepared by our lab specialist) that is just for two groups' use. Make sure that the wells of the gel are closest to the black (negative) electrode and that the gel apparatus has plenty of buffer. Draw a template in your lab notebook so you know which colony is to be put in each lane (1-7 left to right) and which lane contains your DNA ladder. Make sure you get a copy of the DNA ladder key.<BR>
	#Load 15μL of each PCR product into separate wells in the gel. Make sure they are loaded in alphabetical order left to right, A, B, C. <BR>		#Load 15μL of each PCR product into separate wells in the gel. Make sure they are loaded in alphabetical order left to right, A, B, C. <BR>

Tucker Crum: /* Agarose Gel Electrophoresis */

Tucker Crum — Mon, 03 Dec 2012 16:03:23 GMT

Agarose Gel Electrophoresis

←Older revision		Revision as of 16:03, 3 December 2012
Line 112:		Line 112:
	=='''Agarose Gel Electrophoresis'''==		=='''Agarose Gel Electrophoresis'''==
	After the PCR reactions have, we hope, made millions of copies of ''lsy-2'' you will take a sample of the PCR product and run a gel to analyze the results of the amplification (the search for your gene). <BR>		After the PCR reactions have, we hope, made millions of copies of ''lsy-2'' you will take a sample of the PCR product and run a gel to analyze the results of the amplification (the search for your gene). <BR>
-	Add 5 μL of loading dye to each PCR product.<BR>	+	#Add 5 μL of loading dye to each PCR product.<BR>
	You will find a precast 1% agarose gel with Sybr-Safe in 1x TAE buffer (prepared by our lab specialist) that is just for two groups' use. Make sure that the wells of the gel are closest to the black (negative) electrode and that the gel apparatus has plenty of buffer. Draw a template in your lab notebook so you know which colony is to be put in each lane (1-7 left to right) and which lane contains your DNA ladder. Make sure you get a copy of the DNA ladder key.<BR>		You will find a precast 1% agarose gel with Sybr-Safe in 1x TAE buffer (prepared by our lab specialist) that is just for two groups' use. Make sure that the wells of the gel are closest to the black (negative) electrode and that the gel apparatus has plenty of buffer. Draw a template in your lab notebook so you know which colony is to be put in each lane (1-7 left to right) and which lane contains your DNA ladder. Make sure you get a copy of the DNA ladder key.<BR>
-	Load 15μL of each PCR product into separate wells in the gel. Make sure they are loaded in alphabetical order left to right, A, B, C. <BR>	+	#Load 15μL of each PCR product into separate wells in the gel. Make sure they are loaded in alphabetical order left to right, A, B, C. <BR>
-	Load 5 μL of the 100 base pair DNA ladder in the well on the far right. Our standards ladder is product number NEB323-2S from New England Biologicals. The manufacturer supplies the following information about this product.<BR>	+	#Load 5 μL of the 100 base pair DNA ladder in the well on the far right. Our standards ladder is product number NEB323-2S from New England Biologicals. The manufacturer supplies the following information about this product.<BR>
	[[Image:NEB323-S1.jpg]]		[[Image:NEB323-S1.jpg]]
	<BR>		<BR>
-	Run the gel for ~ 20min. at ~120 volts. <BR>	+	#Run the gel for ~ 20min. at ~120 volts. <BR>

	=='''Capturing Digital Images of Nucleic Acid Gels Stained with SYBR Safe Using the BioRad Imaging System in L308''' ==		=='''Capturing Digital Images of Nucleic Acid Gels Stained with SYBR Safe Using the BioRad Imaging System in L308''' ==

Tucker Crum: /* Agarose Gel Electrophoresis */

Tucker Crum — Mon, 03 Dec 2012 16:02:12 GMT

Agarose Gel Electrophoresis

←Older revision		Revision as of 16:02, 3 December 2012
Line 116:		Line 116:
	Load 15μL of each PCR product into separate wells in the gel. Make sure they are loaded in alphabetical order left to right, A, B, C. <BR>		Load 15μL of each PCR product into separate wells in the gel. Make sure they are loaded in alphabetical order left to right, A, B, C. <BR>
	Load 5 μL of the 100 base pair DNA ladder in the well on the far right. Our standards ladder is product number NEB323-2S from New England Biologicals. The manufacturer supplies the following information about this product.<BR>		Load 5 μL of the 100 base pair DNA ladder in the well on the far right. Our standards ladder is product number NEB323-2S from New England Biologicals. The manufacturer supplies the following information about this product.<BR>
-		+	[[Image:NEB323-S1.jpg]]
	<BR>		<BR>
	Run the gel for ~ 20min. at ~120 volts. <BR>		Run the gel for ~ 20min. at ~120 volts. <BR>

Tucker Crum: /* Agarose Gel Electrophoresis */

Tucker Crum — Mon, 03 Dec 2012 16:00:51 GMT

Agarose Gel Electrophoresis

←Older revision		Revision as of 16:00, 3 December 2012
Line 115:		Line 115:
	You will find a precast 1% agarose gel with Sybr-Safe in 1x TAE buffer (prepared by our lab specialist) that is just for two groups' use. Make sure that the wells of the gel are closest to the black (negative) electrode and that the gel apparatus has plenty of buffer. Draw a template in your lab notebook so you know which colony is to be put in each lane (1-7 left to right) and which lane contains your DNA ladder. Make sure you get a copy of the DNA ladder key.<BR>		You will find a precast 1% agarose gel with Sybr-Safe in 1x TAE buffer (prepared by our lab specialist) that is just for two groups' use. Make sure that the wells of the gel are closest to the black (negative) electrode and that the gel apparatus has plenty of buffer. Draw a template in your lab notebook so you know which colony is to be put in each lane (1-7 left to right) and which lane contains your DNA ladder. Make sure you get a copy of the DNA ladder key.<BR>
	Load 15μL of each PCR product into separate wells in the gel. Make sure they are loaded in alphabetical order left to right, A, B, C. <BR>		Load 15μL of each PCR product into separate wells in the gel. Make sure they are loaded in alphabetical order left to right, A, B, C. <BR>
-	Load 5 μL of the 100 base pair DNA ladder in the well on the far right.<BR>	+	Load 5 μL of the 100 base pair DNA ladder in the well on the far right. Our standards ladder is product number NEB323-2S from New England Biologicals. The manufacturer supplies the following information about this product.<BR>

		+	<BR>
	Run the gel for ~ 20min. at ~120 volts. <BR>		Run the gel for ~ 20min. at ~120 volts. <BR>

Tucker Crum: /* Colony PCR */

Tucker Crum — Fri, 16 Nov 2012 16:56:56 GMT

Colony PCR

←Older revision		Revision as of 16:56, 16 November 2012
Line 59:		Line 59:
	#Obtain three PCR tubes and lids from your instructor in your team color.		#Obtain three PCR tubes and lids from your instructor in your team color.
	#Label the '''side''' of each PCR tube A, B and C - the marker WILL rub off the top. Tube C will serve as your negative control with no colony added.		#Label the '''side''' of each PCR tube A, B and C - the marker WILL rub off the top. Tube C will serve as your negative control with no colony added.
-	#Add 30 ul of master mix to each tube. Your master mix will include: 23 μL H<sub>2</sub>O; 3 μL of PCR buffer (10 mM Tris, 50 mM KCl, 1.5 mM MgCl2 pH 8.3); 0.67 μL of 10 mM dNTPs; 0.67 μL of forward primer (20 μM stock); 1 μL of 2 units/μL Taq polymerase. The primer we are using is for T7 polymerase and we are only using one primer rather than two for this amplification. Why do we not need to use both a forward and reverse primer to detect the ''lys-2'' gene in this reaction? <BR>T7 ~~primer sequence:~~<BR>	+	#Add 30 ul of master mix to each tube. Your master mix will include: 23 μL H<sub>2</sub>O; 3 μL of PCR buffer (10 mM Tris, 50 mM KCl, 1.5 mM MgCl2 pH 8.3); 0.67 μL of 10 mM dNTPs; 0.67 μL of forward primer (20 μM stock); 1 μL of 2 units/μL Taq polymerase. The primer we are using is for T7 polymerase and we are only using one primer rather than two for this amplification. Why do we not need to use both a forward and reverse primer to detect the ''lys-2'' gene in this reaction? <BR>
-	~~Forward 5’GAAATTAATACGACTCACTATAGG <BR>~~	+	'''Primer Sequence:''' specific to T7 RNA polymerase promoter on either side of the ''lsy-2'' gene - <br>
		+	5' TAATACGACTCACTATAGGG 3'


Line 68:		Line 69:
	#Snap the lid on the tubes, pulse them briefly in the microcentrifuge with the appropriate rotor and adapter and bring them to the thermal cycler for PCR initiation.		#Snap the lid on the tubes, pulse them briefly in the microcentrifuge with the appropriate rotor and adapter and bring them to the thermal cycler for PCR initiation.
	#Finally, seal the plate with parafilm. Invert it (agar side up so condensation will not drip on your colonies) and store it in the refrigerator in your lab day's rack until the day before the next lab when you will set up an overnight culture from a colony that is positive for ''lsy-2''.		#Finally, seal the plate with parafilm. Invert it (agar side up so condensation will not drip on your colonies) and store it in the refrigerator in your lab day's rack until the day before the next lab when you will set up an overnight culture from a colony that is positive for ''lsy-2''.
-		+
-	~~<br>~~	+
-	~~<br>~~	+
-	~~'''Primer Sequence:''' specific to T7 RNA polymerase promoter on either side of the ''lsy-2'' gene - <br>~~	+
-	~~5' TAATACGACTCACTATAGGG 3'~~	+
	<br><br>		<br><br>
	'''PCR Conditions:'''<br>		'''PCR Conditions:'''<br>

Tucker Crum: /* Colony PCR */

Tucker Crum — Fri, 16 Nov 2012 16:52:30 GMT

Colony PCR

←Older revision		Revision as of 16:52, 16 November 2012
Line 59:		Line 59:
	#Obtain three PCR tubes and lids from your instructor in your team color.		#Obtain three PCR tubes and lids from your instructor in your team color.
	#Label the '''side''' of each PCR tube A, B and C - the marker WILL rub off the top. Tube C will serve as your negative control with no colony added.		#Label the '''side''' of each PCR tube A, B and C - the marker WILL rub off the top. Tube C will serve as your negative control with no colony added.
-	#Add 30 ul of master mix to each tube. Your master mix will include: 23 μL H<sub>2</sub>O; 3 μL of PCR buffer (10 mM Tris, 50 mM KCl, 1.5 mM MgCl2 pH 8.3); 0.67 μL of 10 mM dNTPs; 0.67 μL of forward ~~primer (20 μM stock); 0.67 μL of reverse~~ primer (20 μM stock); 1 μL of 2 units/μL Taq polymerase. The ~~primers~~ we are using ~~are~~ for T7 polymerase. Why? <BR>T7 primer sequence:<BR>	+	#Add 30 ul of master mix to each tube. Your master mix will include: 23 μL H<sub>2</sub>O; 3 μL of PCR buffer (10 mM Tris, 50 mM KCl, 1.5 mM MgCl2 pH 8.3); 0.67 μL of 10 mM dNTPs; 0.67 μL of forward primer (20 μM stock); 1 μL of 2 units/μL Taq polymerase. The primer we are using is for T7 polymerase and we are only using one primer rather than two for this amplification. Why do we not need to use both a forward and reverse primer to detect the ''lys-2'' gene in this reaction? <BR>T7 primer sequence:<BR>
	Forward 5’GAAATTAATACGACTCACTATAGG <BR>		Forward 5’GAAATTAATACGACTCACTATAGG <BR>
-	~~Reverse 5’ CTTTAATTATGCTGATGATATCC~~	+

	#After each tube has master mix, use the sterile end of an autoclaved toothpick (''not'' the end you are touching) or the end of a sterile micropipet tip and gently touch the center of your colony of interest and pick up a tiny, barely visible amount of the bacteria. DO '''NOT TAKE THE ENTIRE COLONY!!!''' Make sure that you select colonies that are large enough to have a significant amount remaining bacteria after taking your sample.		#After each tube has master mix, use the sterile end of an autoclaved toothpick (''not'' the end you are touching) or the end of a sterile micropipet tip and gently touch the center of your colony of interest and pick up a tiny, barely visible amount of the bacteria. DO '''NOT TAKE THE ENTIRE COLONY!!!''' Make sure that you select colonies that are large enough to have a significant amount remaining bacteria after taking your sample.

Melissa Beers: /* Picking a Bacterial Colony */

Melissa Beers — Thu, 15 Nov 2012 19:09:40 GMT

Picking a Bacterial Colony

←Older revision		Revision as of 19:09, 15 November 2012
Line 44:		Line 44:

	== Picking a Bacterial Colony ==		== Picking a Bacterial Colony ==
-	Your instructor will give each pair an LB+ampicillin plate on which bacteria containing our pPD129.36 ''lsy-2'' plasmid are selectively growing. Please pick two well isolated colonies, circle them, label one A and the other B and write your initials and group color on the plastic bottom (agar side) of the plate. <br><br>	+	Your instructor will give each pair an LB+ampicillin plate on which TOP10 bacteria containing our pPD129.36 ''lsy-2'' plasmid are selectively growing. Please pick two well isolated colonies, circle them, label one A and the other B and write your initials and group color on the plastic bottom (agar side) of the plate. <br><br>

	How can you be sure that your colonies contain the plasmid carrying the gene you are interested in studying? In theory, any colony of bacteria growing on your LB+amp plate should contain a plasmid because the gene for antibiotic resistance is not chromosomal, but instead expressed from your plasmid. Because only transformed bacteria are resistant to ampicillin, if we grow the bacteria on or in a medium containing ampicillin, those bacteria that did not take up plasmid DNA should not be able to reproduce to form colonies while those that express plasmid gene products and transfer the plasmid to their progeny will form colonies. The amp resistance gene on the plasmid encodes an enzyme called beta-lactamase. This enzyme is a secreted, soluble protein, which means that there may be smaller, non-transformed, "satellite" colonies around a true transformant. This happens because the ampicillin in the media is destroyed in the area immediately around the colony secreting the enzyme; therefore, there is no ampicillin in the area around the transformant and non-transformed cells can grow and divide enough to form smaller, satellite colonies. You must be careful to pick ONLY the bigger, central colony and not the satellites. The satellite bacteria are unlikely to carry the plasmid that contains the ''C. elegans lsy-2'' gene.<BR><BR>		How can you be sure that your colonies contain the plasmid carrying the gene you are interested in studying? In theory, any colony of bacteria growing on your LB+amp plate should contain a plasmid because the gene for antibiotic resistance is not chromosomal, but instead expressed from your plasmid. Because only transformed bacteria are resistant to ampicillin, if we grow the bacteria on or in a medium containing ampicillin, those bacteria that did not take up plasmid DNA should not be able to reproduce to form colonies while those that express plasmid gene products and transfer the plasmid to their progeny will form colonies. The amp resistance gene on the plasmid encodes an enzyme called beta-lactamase. This enzyme is a secreted, soluble protein, which means that there may be smaller, non-transformed, "satellite" colonies around a true transformant. This happens because the ampicillin in the media is destroyed in the area immediately around the colony secreting the enzyme; therefore, there is no ampicillin in the area around the transformant and non-transformed cells can grow and divide enough to form smaller, satellite colonies. You must be careful to pick ONLY the bigger, central colony and not the satellites. The satellite bacteria are unlikely to carry the plasmid that contains the ''C. elegans lsy-2'' gene.<BR><BR>

Tucker Crum: /* Colony PCR */

Tucker Crum — Tue, 13 Nov 2012 18:15:32 GMT

Colony PCR

←Older revision		Revision as of 18:15, 13 November 2012
Line 59:		Line 59:
	#Obtain three PCR tubes and lids from your instructor in your team color.		#Obtain three PCR tubes and lids from your instructor in your team color.
	#Label the '''side''' of each PCR tube A, B and C - the marker WILL rub off the top. Tube C will serve as your negative control with no colony added.		#Label the '''side''' of each PCR tube A, B and C - the marker WILL rub off the top. Tube C will serve as your negative control with no colony added.
-	#Add 30 ul of master mix to each tube. Your master mix will include: 23 μL H<sub>2</sub>O; 3 μL of PCR buffer (10 mM Tris, 50 mM KCl, 1.5 mM MgCl2 pH 8.3); 0.67 μL of 10 mM dNTPs; 0.67 μL of forward primer (20 μM stock); 0.67 μL of reverse primer (20 μM stock); 1 μL of 2 units/μL Taq polymerase. The primers we are using are for T7 polymerase. Why? T7 primer sequence:<BR>	+	#Add 30 ul of master mix to each tube. Your master mix will include: 23 μL H<sub>2</sub>O; 3 μL of PCR buffer (10 mM Tris, 50 mM KCl, 1.5 mM MgCl2 pH 8.3); 0.67 μL of 10 mM dNTPs; 0.67 μL of forward primer (20 μM stock); 0.67 μL of reverse primer (20 μM stock); 1 μL of 2 units/μL Taq polymerase. The primers we are using are for T7 polymerase. Why? <BR>T7 primer sequence:<BR>
	Forward 5’GAAATTAATACGACTCACTATAGG <BR>		Forward 5’GAAATTAATACGACTCACTATAGG <BR>
	Reverse 5’ CTTTAATTATGCTGATGATATCC		Reverse 5’ CTTTAATTATGCTGATGATATCC