840:153g:Projects/project4/2009/03/12: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 38: Line 38:


''Josh''
''Josh''
* I found some more information on the neutral protease Oggie was looking into. The protein's general name is Bacillolysin, and the gene name is nprE. More information was found at [http://www.uniprot.org/uniprot/P68736]
* I found some more information on the neutral protease Oggie was looking into. The protein's general name is Bacillolysin, and the gene name is nprE. More information was found at the following website [http://www.uniprot.org/uniprot/P68736]. The sequence from the Ferrari paper Oggie found could be confirmed with the reported genomic sequence of ''B. subitilis 168'' found on NCBI.
<!-- ## Do not edit below this line unless you know what you are doing. ## -->
<!-- ## Do not edit below this line unless you know what you are doing. ## -->
|}
|}

Revision as of 14:22, 13 March 2009

MoldBusters' Journal <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Thursday 3/12

Oggie

  • Designed primers for neutral protease gene of B. subtilis strain 168
  • Gene will be used to test the extracted DNA's and as a backup if aprE (alkaline protease subtilisin) can't be cloned again
  • The following primers will be used to clone the entire protease gene
   Forward Primer:
        5’ [TAGAATTCGCGGCCGCTTCTAG]ATGGGTTTAGGTAAGAAATT

   Reverse Primer:
        5’ [ATCTGCAGCGGCCGCTACTAGTA]TTACAATCCAACAGCATTCCA
  • The following primers will be used to clone just the mature product of the protease gene
   Forward Primer Mature:
        5’ [TAGAATTCGCGGCCGCTTCTAG]ATGGCCGCCGCCACTGGAA
  • The following mutated primer will be used if the previous forward primer doesn't work
   Forward Primer Mature C-A mutated:
        5’ [TAGAATTCGCGGCCGCTTCTAG]ATGGC(A)GCCGCCACTGGAA


Josh and Casy

  • Used two liquid cultures of the Bacillus subtilis for genomic DNA extraction, following the protocol from Bionet.
  • Stored the four DNA samples at room temperature in isopropanol.
  • After break, the DNA will be run on a gel to determine if it is ready for use in the aprE gene amplification.

Derek and Katy

  • Ran a PCR amplification of wintergreen as a backup plan since we are running into problems with our original project.
  • Made glycerol stocks for Bacillus subtilis strain 168.

Josh

  • I found some more information on the neutral protease Oggie was looking into. The protein's general name is Bacillolysin, and the gene name is nprE. More information was found at the following website [1]. The sequence from the Ferrari paper Oggie found could be confirmed with the reported genomic sequence of B. subitilis 168 found on NCBI.
Retrieved from "https://openwetware.org/mediawiki/index.php?title=840:153g:Projects/project4/2009/03/12&oldid=293708"