840:153g:Projects/project3

From OpenWetWare

< 840:153g:Projects
Revision as of 20:11, 3 May 2009 by Heather Goodrich (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search

Search this Project

Customize your entry pages


Team Members

  • Neha Yadav
  • Holly Milbach
  • Jenna Fox
  • Heather Goodrich

Project Description

  • We are working on the enzyme Alliinase which is responsible for producing tears when onions are cut. In our project we will be working on the gene sequence that codes for this particular enzyme, clone it, and check it's expression on the E. coli using the substrate as any alkyl cysteine sulphoxide. Specifically we are using 1 propenyl-L-cysteine sulphoxide.
  • Our main goal is to achieve the expression of gene behind the alliinase enzymes, ALL1, in E. coli.
  • We will start our experiment with the extraction of DNA first from the shoots or bulbs of the onions. We will check our DNA with the primers and if it works then we will extract RNA from bulbs of the onion. With the RNA we will start our reverse transcriptase PCR to get the amplified copies of the gene of interest (ALL1).
  • The nucleotide sequences of both the the complete ALL1 gene and RNA are listed below from the NCBI website.
        *  Gene:  [1]
        *  mRNA:  [2]
  • We were able to get the accession number for the nucleotide sequences from an article on the Wiley InterScience website [3]
  • The gene specific oligonucleotide primer sets for RT-PCR are as follows:

Specific for ALL1

       *AF2 (5'- GTATATGCAACAAAACTCTG -3')
       *AR2 (5'-ACAAGAGGTTTCAGTTTCTG tactagtagcggccgctgcag-3')

Specific for bulb allinase

       *GF (5'-tactagtagcggccgctgcagTAGCAATGGTTAAAACACAG-3')
       *GR (5'-GATCATTGGAAAGTTGTTTGtactagtagcggccgctgcag-3')

Specific for root allinase

       *RF (5'-tactagtagcggccgctgcagTCCCTTCAGGAAATATCTGC-3')
       *RR (5'-ACTCGTAGCTTCCTTCATCGtactagtagcggccgctgcag-3')

We found this from an article on the Science Direct website [4]

  • The gene specific oligonucleotide primer sets we designed ourselves:
   * Signal Peptide:  5’-  gaattcgcggccgcttctag  atggagtcttaccacaaagt -3’
   * Mature  Peptide: 5’- gaattcgcggccgcttctag  atg aaggtgacatggagtttgaa -3’
   * 3' UTR Stop Signal: 5'- ctgcagcggccgctactagta ttaaatgaaaggacggcggg-3'


  • Then the promoters/vectors that we'll be using for these sequences were found on the Biological Parts Registry. Experience with all of these WORKS.
 * BBa_I719005              T7 Promoter   [[5]]
           Physical DNA:    Library: Spring 2008      Well: 3G    Plasmid: pSB1A2         Source Plate: 1006
 * BBa_I712074              T7 promoter (strong promoter from T7 bacteriophage)  [[6]]
           Physical DNA:    Library: Spring 2008      Well: 5E    Plasmid: pSB1AK8        Source Plate: 1017
 * BBa_I715038              pLac-RBS-T7 RNA Polymerase   [7]
           Physical DNA:    Library: Spring 2008      Well: 6H    Plasmid: pSB1AK3        Source Plate: 1018
 * BBa_J13002                 TetR repressed POPS/RIPS generator    [8]
          Physical DNA:     Library: Spring 2008      Well: 3F    Plasmid: pSB1A2         Cell: V1009
  • Restrictions Enzymes were examined on the Fermentas Life Science website and our gene contains Ecor1 site. To make this biobrick compatible site directed mutagenesis will be performed to remove the Ecor1.
  • With these basic tools and information work in the lab can begin.

Steps

  • Identify Gene of Interest: ALL1
        Gene size: 4014 basepairs
        mRNA size: 1587 basepairs
  • Identify Biobrick sites: To make it biobrick compatible site directed mutagenesis to remove Ecor1 will be performed. Ecor1 is located in the mRNA at position 196. In the complete gene Ecor1 has two locations at positions 910 and 1580.
  • Identify the Source: Initially DNA will be extracted from bulbs or shoots from onions. The DNA will be combined with the primers to ensure that they work. If they do we will extract RNA from our onion using the bulbs or shoots. RNA will then be used to do the rest of our experiment. However, if the RNA does not work well then DNA will be used and an introns will need to be spliced out.
  • Extraction of DNA and RNA
         DNA: [9]
         RNA: [10]
  • Identification of primers: As mentioned above
  • Amplification of gene of Interest: Using RT-PCR for RNA and PCR for DNA
  • Selection of vectors: As mention above
  • Put gene of interest into vector: Using standard biobrick assembly
  • Transform competent cells with our vector insert construct. The plasmid and insert will be cut, mixed, and ligated together to make the transform cells. For the ligation we will be using ligation enzymes.
  • Selection of recombinant colonies using amphicillian and other chemicals like tetracycline.
  • Make minipreps:
  • Digest with restriction enzymes and run a gel to compare vector band and insert band. We will save recombinant DNA colonies as a backup.
  • Sequence the whole construct using DNA sequencing
  • Test functionality and expression using E. coli and substrate 1 propenyl-L-cysteine sulphoxide. To test our functionality we will have two petri dishes one with the recombinant E. coli and one with normal E. coli both using substrate 1 propenyl-L-cysteine sulphoxide. We will have a set number of people smell it and compare the two based on odor.

Summary

  • Our initial goal was to clone the alliinase gene, however, we were unsuccessful as we were never able to get our primers to work with our DNA or RNA. We were able to extract DNA and RNA. We were also able to cut and purify the plasmids in order to get them ready to insert the gene of interest. Despite our lack of success we were still able to learn a lot of techniques such as DNA/RNA extraction, PCR/RT-PCR, gel electrophoresis, purifying plasmids, transforming competent cells, plating, and making glycerol stocks.


Image:ONION.ppt


Image:ONION.pdf



Recent changes




Personal tools