840:153g:Projects/project27

Team Members

• Austin Jones
• Jace Dolphin

Expression of methane monooxygenase in E. coli for biodegradation of methane

• A small group of bacteria are termed methanotrophs (e.g. Methylomonas sp., Methylosinus sp., Methylocystis sp.), in that they have the ability to oxidize the C-H bond in methane. This allows methanotrophs the unique ability to not only grow using methane as the sole carbon source, but to oxidize a wide range of hydrocarbons, including chlorinated compounds. For this reason, this group of bacteria has been the focus of research concerning the bioremediation of various environmental pollutants, including the two focused on in this project: petroleum and trichloroethylene (TCE).[1]
• This catalytic ability comes from the soluble enzyme system, methane monooxygenase (MMO), which consists of three enzyme groups[2] coded for by a ~10kb gene cluster.[3] We will attempt to clone two segments of the gene cluster E. coli. The sequences for the genes mmoX and mmoY will be included in one segment, and the sequences for the genes mmoB, mmoZ, mmoD, and mmoC will be in the other sequence. The ability of the transformed E. coli cells to show methanotrophic metabolism will be tested by quantifying their ability to oxidize methane and TCE.

• Gene Accession Number: X55394 [4]

• PCR Primers:

  27F_mmoXY - 5' gaattcgcggccgcttctagatggcgatcagtctcgctac 3'
  27R_mmoXY - 5' ctgcagcggccgctactagtatcagttgtcgggcgtaatcg 3'
  27F_mmoBZDC - 5' gaattcgcggccgcttctagatgtccagcgctcataacgc 3'
  27R_mmoBZDC - 5' ctgcagcggccgctactagtatcagccgctcgccaggaatt 3'

• Vectors: pSB1A3 (ampicillin R.) [5], pSB1K3 (kanamycin R.) [6]

• Promoter: BBa_J23100 [7]

• Project Steps:

-DNA Extraction

-PCR – 2 genes amplified

-Digestion/Ligation

 X-Y - pSB1A3 (ampicillin R.)
 B-Z-D-C - pSB1K3 (kanamycin R.)

-Clone each into E. coli, grow on media, add appropriate antibiotic after each round

-Test ability to digest methane, TCE

 -Potassium permanganate
   -If methanol is present, solution will turn blue and produce odor
 -Tryptophan
    -Test for glyoxylic acid (byproduct of TCE digestion)
    -Tryptophan will react with glyoxylic acid and form a red/violet precipitate in solution

• Proposal Powerpoint [8]
• Results Powerpoint [9]

Reference Materials:

-Shigematsu, Toru, Satoshi Hanada, Masahiro Eguchi, and Yoichi Kamagata. "Soluble Methane Monooxygenase Gene Clusters from Trichloroethylene-Degrading Methylomonas sp. Strains and Detection of Methanotrophs during In Situ Bioremediation." APPLIED AND ENVIRONMENTAL MICROBIOLOGY 65.12 (1999): 5198-206. NCBI. NIH, Dec. 1999. Web. 27 Aug. 2012. <http://www.ncbi.nlm.nih.gov/pmc/articles/PMC91705/pdf /am005198.pdf>.

-Maarten Merkx Dr., Daniel A. Kopp, Matthew H. Sazinsky, Jessica L. Blazyk, Jens Müller Dr., Stephen J. Lippard Prof. Dr.

      "Dioxygen Activation and Methane Hydroxylation by Soluble Methane Monooxygenase: A Tale of Two Irons and Three Proteins."  Angew. Chem. Int.  2001, 40: 2782-2807 http://onlinelibrary.wiley.com/doi/10.1002/1521-3773(20010803)40:15%3C2782::AID-ANIE2782%3E3.0.CO;2-P/full

=Important Results and Milestones==

• keep track of your most important results and refer to the corresponding page in your notebook
• upload important pictures (don't forget to label them! Powerpoint is very convenient). Remember: these will become quite handy later in your summary report or final presentation. If you do label and upload the pictures as soon as you got them, your summary report can be written much more effortlessly (do you usually procrastinate? This is chance to do some work before hand that frees you up for finals week).

Recent changes