840:153g:Projects/project25

Team Tango Alpha

• Bess Lippmann
• Colby Swanson

Cloning of mreB from Caulobacter crescentus into E. coli

To see our full project description see initial project presentation: [[1]]

The goal of our project is to clone the gene, mreB, from Caulobacter crescentus (stalked shaped cell) into Escherchia coli (rod shaped cell) to see if mreB will affect E. coli's cell shape in some way. We expect to see the E. coli cells lyse or change from their normal rod shape.

Normal E. coli cell shape [[2]] Normal C. crescentus cell shape [[3]] Lysed E. coli cells [[4]] Abnormal E. coli cells [[5]], [[6]]

MreB is a rod-shape determining gene that appears as bands or spirals encircling the cell. It is known to associate with mreC and penicillin-binding proteins to catalyze precursors for the peptidoglycan cell wall and correctly position polar bacterial proteins. It is also homologous of actin in eukaryotes.

Parts

• Tissue Source: wild type C. crescentus CB15N (generously donated from the lab of Christine Jacobs-Wagner at Yale University)

• Gene of Interest: mreB from C. crescentus {Accession# NC_011916, 1,044 bp, no introns} [7]

• Primers: Forward primer: the first 34 bases of our gene sequence. We also added in the Biobrick enzymes EcoR1 and Xba1 in front of the primer. Reverse primer: the last 20 bases of our gene sequence. We also added in the Biobrick enzymes Pst1 and Spe1 in front of the primer. [[8]], [[9]]

Forward Primer: 5' ATGTTCTCTTCCCTTTTCGGCGTGATCTCGAACG 3' Reverse Primer: 5' CTAGGCCAGCGTGGATTCCA 3'

• Promoter: BBa_K206000 (pBad Strong Promoter). This promoter is inducible by L-arabinose. When induced, AraC binds and changes the conformation interacting with Aral1 and Aral2 operator sites, permitting transcription.

• Plasmid Vector: pSB1A3. This is a Biobrick part containing an ampicillin marker gene.

Procedure

• Grow C. crescentus on PYE media and E. coli on LB media
• PCR to amplify mreB gene + Biobrick (BB) genes
• Isolate and purify mreB + BB genes
• Cut mreB + BB enzymes and ligate with pSB1A3
• Perform bacterial transformation to import the plasmid into E. coli
• Grow E. coli bacteria on experimental plates (No ampicillin, ampicillin, and ampicillin + L-arabinose)
• Verification testing by examining the physical cell shapes under a light microscope and sequence verification by sending a sample of cloned DNA to Iowa State.

References

Gitai, Z., & Yakhnina, A.A. (2012). The small protein mbiA interacts with mreB and modulates cell shape in caulobacter crescentus. Molecular Microbiology. doi: 10.1111/j.1365-2958.2012.08159.x [10]

Jacobs-Wagner, C., et al. (2012). Osmolality dependent relocation of penicillin-binding protein PBP2 to the division site in caulobacter crescentus. Journal of Bacteriology. doi: 10.1128 [11]

Recent changes