840:153g:Projects/project20

From OpenWetWare

< 840:153g:Projects
Revision as of 18:19, 7 December 2011 by Xiaoyang Feng (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search

Search this Project

Customize your entry pages

Team Members

  • Xiaoyang Feng
  • Maliha Saggaf
  • Srikanth Sistla

Cloning and expression of neutral protease gene from B. Stearothermophilus (TIC)

  • The gene (nprT) responsible for producing the thermostable enzyme 'neutral protease' will be extracted from a thermophilic bacteria called Bacillus Stearothermophilus. This enzyme functions to hydrolyze specific proteins including fibronectin, collagen IV and also collagen I. The gene nprT was then sequenced using NCBI Genbank with the accession number M11446.1. It contains 1881 bp with no introns. This is because ideally, bacterias do not contain introns. We are currently working on designing 2 sets of primers, one containing Biobrick compatible ends and the other one shall not contain Biobrick compatible ends. The next step is to amplify the targeted gene using PCR. Then, we shall cleave the plasmid and the nprT, followed by ligation of the two.When this process is successfully done, the plasmid shall then be transformed into competent E.coli. At this point, we culture the E.coli at high temperature ( the specific temperature is to be determined ), and determine if neutral protease shall be produced. The necessary tests to detect the production of neutral protease shall then be done.Only then, we would know if the transformation was successful or not.

primers

  • 20_thermo_F: 5’ ATG AAC AAA CGG GCG ATG C
  • 20_thermo_R: 5’ TTA ATA CAC TCC AAC CGC ATT G
  • 20_thermowithbio_F: 5’ GAATTCGCGGCCGCTTCTAG ATG AAC AAA CGG GCG ATG C
  • 20_thermowithbio_R: 5’ TACTAGTAGCGGCCGCTGCAG TTA ATA CAC TCC AAC CGC ATT G

promoters

  • 1.Part:BBa_K091112 (first choice)
http://partsregistry.org/wiki/index.php?title=Part:BBa_K091112
  • 2.Part:BBa_K206001
http://partsregistry.org/wiki/index.php?title=Part:BBa_K206001
  • 3.Part:BBa_I0500
http://partsregistry.org/wiki/index.php?title=Part:BBa_I0500


Primary source

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC219205/pdf/jbacter00220-0018.pdf 

Secondary Source

*1. http://www.springerlink.com/content/2176020225j772uh/
*2. http://mic.sgmjournals.org/content/134/7/1883.long

First presentation

http://openwetware.org/wiki/Image:Project_Proposal.pptx

Final presentation

http://openwetware.org/wiki/Image:TIC_group_20.pptx

Important Results and Milestones

  • keep track of your most important results and refer to the corresponding page in your notebook
  • upload important pictures (don't forget to label them! Powerpoint is very convenient). Remember: these will become quite handy later in your summary report or final presentation. If you do label and upload the pictures as soon as you got them, your summary report can be written much more effortlessly (do you usually procrastinate? This is chance to do some work before hand that frees you up for finals week).

Recent changes




Personal tools