840:153g:Projects/project19/2011/11/08: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
(Autocreate 2011/11/08 Entry for 840:153g:Projects/project19)
 
No edit summary
 
Line 1: Line 1:
We will be cloning the Cstps1 Gene from Citrus Sinensis.  This gene is responsible for producing an enzyme which reacts with FPP (farnesyl pyrophosphate)to produce valencene, the major component of the citrus scent of oranges.  The gene was located on the Genbank of the NCBI website with the accession number AF441124.1.  The gene contains 1647 bp without introns.  We will design 2 different sets of primers.  One set will be compatible with the biobrick ends and the other set will not.  After the gene is cloned, it will be transformed into E. coli, in a select media containing FPP.  If we are able to smell the oranges, our research was successful.  We may also develop another way to test for the scent if it is not evident that it is there right away.
Results of the most recent PCR were extraordinarily disappointing.  Despite practice, skill, and experimentally obtained optimization of the PCR program, something went horribly wrong.  Most alarming was no visible amplified DNA.  One or several factors may have contributed to these results.  We carefully prepared multiple samples and repeated the PCR.  Most likely and hopefully, the results, or lack thereof, were the result of a simple human error.  If that is the case, then we should see more appropriate results from today's amplification.
 
 
Our primers are:
19_orange1_F: atgtcgtctggagaaacatt
 
19_orange2_R:  tcaaaatggaacgtggtctc
 
19_orange1a_F: gaattcgcggccgcttctagatgtcgtctggagaaacatt
 
19_orange2a_R: tactagtagcggccgctgcagtcaaaatggaacgtggtctc
 
Our promoters to test are:
BBa_I13453
BBa_I0500
BBa_I765001
 
Accession number to the mRNA of the gene:
AF441124

Latest revision as of 11:50, 10 November 2011

Results of the most recent PCR were extraordinarily disappointing. Despite practice, skill, and experimentally obtained optimization of the PCR program, something went horribly wrong. Most alarming was no visible amplified DNA. One or several factors may have contributed to these results. We carefully prepared multiple samples and repeated the PCR. Most likely and hopefully, the results, or lack thereof, were the result of a simple human error. If that is the case, then we should see more appropriate results from today's amplification.

Retrieved from "https://openwetware.org/mediawiki/index.php?title=840:153g:Projects/project19/2011/11/08&oldid=565753"