|
|
| Line 1: |
Line 1: |
| We will be cloning the Cstps1 Gene from Citrus Sinensis. This gene is responsible for producing an enzyme which reacts with FPP (farnesyl pyrophosphate)to produce valencene, the major component of the citrus scent of oranges. The gene was located on the Genbank of the NCBI website with the accession number AF441124.1. The gene contains 1647 bp without introns. We will design 2 different sets of primers. One set will be compatible with the biobrick ends and the other set will not. After the gene is cloned, it will be transformed into E. coli, in a select media containing FPP. If we are able to smell the oranges, our research was successful. We may also develop another way to test for the scent if it is not evident that it is there right away.
| | Today we ran a gel of the DNA that we extracted last week t ensure that we got DNA. We also made a plan for next time and how we are going to adjust the PCR. |
| | |
| | |
| Our primers are:
| |
| 19_orange1_F: atgtcgtctggagaaacatt
| |
| | |
| 19_orange2_R: tcaaaatggaacgtggtctc
| |
| | |
| 19_orange1a_F: gaattcgcggccgcttctagatgtcgtctggagaaacatt
| |
| | |
| 19_orange2a_R: tactagtagcggccgctgcagtcaaaatggaacgtggtctc
| |
| | |
|
| |
| Our promoters to test are:
| |
| BBa_I13453
| |
| BBa_I0500
| |
| BBa_I765001
| |
| | |
| Accession number to the mRNA of the gene:
| |
| AF441124
| |
Revision as of 17:11, 25 October 2011
Today we ran a gel of the DNA that we extracted last week t ensure that we got DNA. We also made a plan for next time and how we are going to adjust the PCR.
