840:153g:Projects/project19/2011/09/27: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
(Autocreate 2011/09/27 Entry for 840:153g:Projects/project19)
 
No edit summary
 
Line 1: Line 1:
We will be cloning the Cstps1 Gene from Citrus Sinensis.  This gene is responsible for producing an enzyme which reacts with FPP (farnesyl pyrophosphate)to produce valencene, the major component of the citrus scent of oranges.  The gene was located on the Genbank of the NCBI website with the accession number AF441124.1.  The gene contains 1647 bp without introns.  We will design 2 different sets of primers.  One set will be compatible with the biobrick ends and the other set will not.  After the gene is cloned, it will be transformed into E. coli, in a select media containing FPP.  If we are able to smell the oranges, our research was successful.  We may also develop another way to test for the scent if it is not evident that it is there right away.
9/27 - Today we performed RE digest and agarose gel electrophoresis using the DNA that we extracted and purified last week with the corrected protocol.  Analysis of the gel once again shows no or insufficient DNA extraction.  We will next try to extract DNA using the specialized albeit more complex procedure developed specifically for citrus DNA extraction.


 
We also diluted our 4 custom primers, which had arrived last week, with PCR-ready (UV-irradiated) distilled water to make 100 µM solutions.
Our primers are:
19_orange1_F: atgtcgtctggagaaacatt
 
19_orange2_R:  tcaaaatggaacgtggtctc
 
19_orange1a_F: gaattcgcggccgcttctagatgtcgtctggagaaacatt
 
19_orange2a_R: tactagtagcggccgctgcagtcaaaatggaacgtggtctc
 
Our promoters to test are:
BBa_I13453
BBa_I0500
BBa_I765001
 
Accession number to the mRNA of the gene:
AF441124

Latest revision as of 15:27, 27 September 2011

9/27 - Today we performed RE digest and agarose gel electrophoresis using the DNA that we extracted and purified last week with the corrected protocol. Analysis of the gel once again shows no or insufficient DNA extraction. We will next try to extract DNA using the specialized albeit more complex procedure developed specifically for citrus DNA extraction.

We also diluted our 4 custom primers, which had arrived last week, with PCR-ready (UV-irradiated) distilled water to make 100 µM solutions.

Retrieved from "https://openwetware.org/mediawiki/index.php?title=840:153g:Projects/project19/2011/09/27&oldid=541848"