840:153g:Projects/project17

Team Members

• Charlie Chase
• Sheree Harper
• Amanda Brase

Cloning the Progesterone 5-beta Reductase Gene from Selaginella moellendorffii

Originally, we wanted to clone the gene responsible for making the monarch butterfly taste bad to birds and/or make them sick. We were unable to find any genes responsible for this, since they actually sequester normally toxic chemicals from the milkweed plant. The plants produce these chemicals (known as cardenolides) via a biochemical pathway of which the enzyme progesterone 5-beta reductase is a part. This enzyme metabolizes progesterone into 5-beta-pregnane-3,20-dione, which is a steroid metabolite. Since there is no recorded gene sequence for this enzyme in the milkweed plant, we will be using a gene from a species of spike moss. We plan to order our Selaginella moellendorffii online from Plant Delights Nursery. Our gene sequence was located in the NCBI GenBank. Its accession number is NW_003314261. It is 1185 base pairs in length, and contains no introns. We will be amplifying our gene after extracting it from the plant. Included in our reverse primer will be BioBrick extensions with SpeI and PstI restriction sites. We will be using our forward primer to perform site-directed mutagenesis on one nucleotide that was part of a XbaI restriction site. Therefore, we will not be using the EcoRI and XbaI BioBrick extensions as the primer would be too long to work properly. After amplification using PCR, we will insert our DNA strand into a pGEM-T Easy Vector. We will then amplify it out of the T Vector using a primer with the included BioBrick prefix, and using XbaI and SpeI enzymes to make our strand and a target BioBrick vector (with promoter) compatible, and then ligate them together. Our completed plasmid will then be inserted into E. coli bacteria which will then be grown on an agar plate. If we use the pLacI/ara-1 promoter, we will have to add arabinose to induce it. We will also need to introduce progesterone to the bacteria so that they can use our inserted gene to metabolize it into 5-beta-pregnane-3,20-dione, which we will test for using high performance liquid chromatography.

Primers

17_P5βRa-F

atgtgctcactgcttcctctctgctgctccagaacagag

17_P5βRb-R

tcagctggtccaaaatttgtcgtc

17_P5βRc-F (too long to use in PCR)

gaattcgcggccgcttctagatgtgctcactgcttcctctctgctgctccagaacagag

17_P5βRd-R

gaattcgcggccgcttctagagtcagctggtccaaaatttgtcgtc

Promoters

BBa_K091110 LacI Promoter (Library 2009 Submissions)

BBa_K091111 LacIQ Promoter (Library 2009 Submissions)

BBa_K094120 pLacI/ara-1 (Library 2008 Submissions, Need IPTG or arabinose to induce promoter)

Reference article: Evolution of steroid-5-alpha-reductases in comparison of their function with 5ß-reductase DOI: 10.1016/j.ygcen.2009.08.004

• Please also make yourself familiar with uploading pictures and *.ppt files

Important Results and Milestones

• keep track of your most important results and refer to the corresponding page in your notebook
• upload important pictures (don't forget to label them! Powerpoint is very convenient). Remember: these will become quite handy later in your summary report or final presentation. If you do label and upload the pictures as soon as you got them, your summary report can be written much more effortlessly (do you usually procrastinate? This is chance to do some work before hand that frees you up for finals week).

Recent changes