840:153g:Projects/project16

From OpenWetWare

Jump to: navigation, search

Search this Project

Customize your entry pages

Team Members

  • Kelsey Hampton and Jack Kosmicki

Project Name and Description

We elected to clone the T1R3 gene to produce mammalian sweet taste receptors from humans. The gene sequence was acquired from the NCBI database of which the source is a patent. The accession number for the gene is: DJ044031. The T1R3 gene contains 2553 base pairs and 0 introns. DNA will be extracted from my mouth. We will amplify the gene with PCR using flanking primers that have been designed specifically for this gene sequence. We chose original sets of gene-specific primers of 17 base pairs each that minimized potential formation of secondary structures within the primers themselves. Two sets of primers will be used: the gene-specific set and a set that contains the gene-specific sequence and BioBrick compatible restriction sites. We have elected to first try to amplify the gene using the BioBrick compatible primers into a vector containing our promoter. Our promoter will be chosen from a short list chosen from the BioBricks registry website. If this fails, we will utilize the gene specific primers and then insert our amplified gene into a T-vector. The plasmid vector possessing our clone will be transferred to E. Coli and allowed to mature. The mature E. coli colony is expected to produce the T1R3 taste receptor molecule. All the while we will be performing a simultaneous cloning process using the miraculin gene from the BioBrick library. We will isolate the miraculin protein product and combine the miraculin protein with the T1R3 receptor. As of yet, we have not found the native gel conditions for this receptor which are required to observe the functionality of the T1R3 protein combined with a protein molecule. If said native gel conditions are located, we will perform an SDS-PAGE analysis of the miraculin protein, the T1R3 receptor, and a combination of the two which should contain bound T1R3-miraculin molecules.

Patent Source: http://www.wipo.int/patentscope/search/en/WO2005033125


Gene: http://www.ncbi.nlm.nih.gov/nuccore/DJ044031.1

Accession Number: DJ044031


Primers:

16_T1R3a_F: ATGCTGGGCCCTGCTGT

16_T1R3a_R: TCACTCATGTTTCCCCT


16_T1R3BBa_F: GAATTCGCGGCCGCTTCTAGATGCTGGGCCCTGCTGT

16_T1R3BBa_R: TACTAGTAGCGGCCGCTGCAGTCACTCATGTTTCCCCT

PstI #1

16_T1R3b_F: CGGAGCTGCTTCAGGAGTTCGG

16_T1R3b_R: CCGAACTCCTGAAGCAGCTCCG


PstI #2

16_T1R3c_F: GCATCACGCTTCAGAACGT

16_T1R3c_R: ACGTTCTGAAGCGTGATGC


PstI #3

16_T1R3d_F: CACTCTTCCTTCAGGCGGCCGA

16_T1R3d_R: TCGGCCGCCTGAAGGAAGAGTG

Promoter: .pBAD strong (Bba_K206000)


Presentation: http://openwetware.org/wiki/Image:CloningHumanTasteReceptorGeneTAS1R3%2BMiraculin.pptx Final Presentation: http://openwetware.org/wiki/Image:Cloning_the_T1R3_Gene2.0.pptx


Important Results and Milestones

  • upload important pictures (don't forget to label them! Powerpoint is very convenient). Remember: these will become quite handy later in your summary report or final presentation. If you do label and upload the pictures as soon as you got them, your summary report can be written much more effortlessly (do you usually procrastinate? This is chance to do some work before hand that frees you up for finals week).

Recent changes




Personal tools