840:153g:Projects/project10/2010/09/30: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
Gabe Martin (talk | contribs) |
Gabe Martin (talk | contribs) No edit summary |
||
(2 intermediate revisions by the same user not shown) | |||
Line 6: | Line 6: | ||
| colspan="2"| | | colspan="2"| | ||
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit above this line unless you know what you are doing. ##### --> | ||
==Entry title== | [[Image:[[Image:9_30_10Group10.jpg]]]]==Entry title== | ||
* This week we finished DNA extraction from P. chrysosporium and ran a gel electrophoresis to determine presence of DNA. We also figured out our primers - forward with biobrick extension, reverse with biobrick extension, forward without biobrick extension, and reverse without biobrick extension - to be ordered. | * This week we finished DNA extraction from P. chrysosporium and ran a gel electrophoresis to determine presence of DNA... it worked! We know it worked because we see DNA on the gel. We also figured out our primers - forward with biobrick extension "Sneezy" GTTTCTTCGAATTCGCGGCCGCTTCTAGCCTTCGTATGTAAGTCGCTG, reverse with biobrick extension "Cowgirl" TACTAGTAGCGGCCGCTGCAGGAAGAAACCGCCGTGCGCGAGTCGCGCG, forward without biobrick extension "Grumpy" CCTTCGTATGTAAGTCGCTG, and reverse without biobrick extension "Cowboy" CGCCGTGCGCGAGTCGCGCG - to be ordered. | ||
Next time we will hopefully receive our primers and run PCR to determine if the primers work. | Next time we will hopefully receive our primers and run PCR to determine if the primers work. | ||
Revision as of 12:46, 7 October 2010
Project name | <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> |
Next time we will hopefully receive our primers and run PCR to determine if the primers work.
|