840:153g:Projects/project1/2008/09/30: Difference between revisions
No edit summary |
No edit summary |
||
| Line 5: | Line 5: | ||
|- | |- | ||
| colspan="2"| | | colspan="2"| | ||
Our field of Dreams | Our field of Dreams | ||
The mRNA sequence that was used to create the primers was found on GenBank with accession number DQ148458 [http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=73665492] | The mRNA sequence that was used to create the primers was found on GenBank with accession number DQ148458 [http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=73665492]. The primers were designed from the complementary reverse sequence of the DQ148458. Once the sequence was reversed then we found the location of the start and stop from the Genbank website. The coding region if the sequence is from 208 to 1728 which the primers were designed from these locations. The primer design was done by the program Amplify 1.2 on Dr. James Jurgenson Lab computer at the University if Northern Iowa. The sequence was entered into the program with the forward and reverse sequences of the primers. To make sure that we amplify the gene sequence we reversed the reverse primer sequence. The forward primer is catgtccatcttcctcatcgcaacc and the reverse primer is tcctttcatcaaacaaaccccatacgc. We have named the primers F2mRNA (forward) and R2mRNA (reverse). Then the computer program displayed the output of how much of the sequence will be amplified and the probability of this occurring form a 92% chance of this working in our own lab. Both primers had a primablitiy of 100% which means that they are very likely to amplify this region. The forward primer had a 76% stability match and the reverse primer had a 72% stability. The sequence had a base composition of GC 52.8%. The forward primer had 52% and the reverse primer had 44%. The sequence that was amplified for the gene was 1532 base pairs. The results for the primer design are as shown in figures below. The protocol that we will be using for the RNA extraction is as the manufacture suggested on the company website [http://tools.invitrogen.com/content/sfs/manuals/15596018%20pps%20Trizol%20Reagent%20061207.pdf]. | ||
<!-- ## Do not edit below this line unless you know what you are doing. ## --> | <!-- ## Do not edit below this line unless you know what you are doing. ## --> | ||
|} | |} | ||
Revision as of 14:53, 30 September 2008
 A Flower of a Different Color by "Emblazon"
|
<html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> |
|
Our field of Dreams The mRNA sequence that was used to create the primers was found on GenBank with accession number DQ148458 [1]. The primers were designed from the complementary reverse sequence of the DQ148458. Once the sequence was reversed then we found the location of the start and stop from the Genbank website. The coding region if the sequence is from 208 to 1728 which the primers were designed from these locations. The primer design was done by the program Amplify 1.2 on Dr. James Jurgenson Lab computer at the University if Northern Iowa. The sequence was entered into the program with the forward and reverse sequences of the primers. To make sure that we amplify the gene sequence we reversed the reverse primer sequence. The forward primer is catgtccatcttcctcatcgcaacc and the reverse primer is tcctttcatcaaacaaaccccatacgc. We have named the primers F2mRNA (forward) and R2mRNA (reverse). Then the computer program displayed the output of how much of the sequence will be amplified and the probability of this occurring form a 92% chance of this working in our own lab. Both primers had a primablitiy of 100% which means that they are very likely to amplify this region. The forward primer had a 76% stability match and the reverse primer had a 72% stability. The sequence had a base composition of GC 52.8%. The forward primer had 52% and the reverse primer had 44%. The sequence that was amplified for the gene was 1532 base pairs. The results for the primer design are as shown in figures below. The protocol that we will be using for the RNA extraction is as the manufacture suggested on the company website [2]. | |
