20.109(S13):Phylogenetic analysis (Day7)
From OpenWetWare
(Difference between revisions)
(→Part 1: Prepare sequences for analysis) |
(→Part 1: Prepare sequences for analysis) |
||
| Line 17: | Line 17: | ||
#Paste the reverse sequence of your first candidate into yet another ApE file. Use Edit → Reverse Complement to adjust the sequence, and again trim away the vector. | #Paste the reverse sequence of your first candidate into yet another ApE file. Use Edit → Reverse Complement to adjust the sequence, and again trim away the vector. | ||
#Use ''Tools'' → ''Align Sequence'' to find where the forward and reverse sequences overlap. Combine them into one sequence with no repeated parts; when both forward and reverse sequence have coverage of the gene, choose whatever combination has the fewest Ns (ideally none!). Save this sequence as a new file called 20109_YourTeamDay-YourTeamColor_YourSampleID-"C"Candidate Number (e.g., 20109_WF-Purple_G737-C1). | #Use ''Tools'' → ''Align Sequence'' to find where the forward and reverse sequences overlap. Combine them into one sequence with no repeated parts; when both forward and reverse sequence have coverage of the gene, choose whatever combination has the fewest Ns (ideally none!). Save this sequence as a new file called 20109_YourTeamDay-YourTeamColor_YourSampleID-"C"Candidate Number (e.g., 20109_WF-Purple_G737-C1). | ||
| + | #Finally, depending on the orientation of your insert, you may want to reverse complement the entire sequence. Use the original sequences of the forward and reverse 16S primers to guide your decision. | ||
| + | |||
| + | Forward: 5' AGAGTTTGATCCTGGCTCAG <br> | ||
| + | Reverse: 5' ACGGGCGGTGTGTACA | ||
===Part 2: Identify species from sequences=== | ===Part 2: Identify species from sequences=== | ||
Revision as of 11:58, 21 January 2013
Contents |
Introduction
phylogenetic analysis, utility
Protocols
Part 1: Prepare sequences for analysis
The data from Genewiz is available at this link. Choose the "Login" link and then use "astachow@mit.edu" and "be20109" to log in. At the bottom right should be a link to download your sequencing results. Select order date XXX for T/R results and XXX for W/F results. The quickest way to start working with your data is to follow the "View" link under the Seq File heading. For ambiguous data, you may want to look directly at the Trace File as well.
- Begin by downloading this file, which contains the DNA sequence of the vector we are using in GenBank format. Open the file in ApE (A plasmid Editor, created by M. Wayne Davis at the University of Utah), which is found on your desktop. Three items of interested are highlighted: the forward priming site, the reverse priming site and the two basepairs between which your sequence should be inserted.
- Paste the forward sequence of your first candidate into a new ApE file. Locate where the vector ends and the insert begins; trim away the vector.
- Paste the reverse sequence of your first candidate into yet another ApE file. Use Edit → Reverse Complement to adjust the sequence, and again trim away the vector.
- Use Tools → Align Sequence to find where the forward and reverse sequences overlap. Combine them into one sequence with no repeated parts; when both forward and reverse sequence have coverage of the gene, choose whatever combination has the fewest Ns (ideally none!). Save this sequence as a new file called 20109_YourTeamDay-YourTeamColor_YourSampleID-"C"Candidate Number (e.g., 20109_WF-Purple_G737-C1).
- Finally, depending on the orientation of your insert, you may want to reverse complement the entire sequence. Use the original sequences of the forward and reverse 16S primers to guide your decision.
Forward: 5' AGAGTTTGATCCTGGCTCAG
Reverse: 5' ACGGGCGGTGTGTACA
Part 2: Identify species from sequences
REVISE FROM PREVIOUS
Align with "bl2seq" from NCBI
- The alignment program can be accessed through the NCBI BLAST page or directly from this link. The default settings should be fine.
- Paste the sequence text from your sequencing run into the "Query" box. This will now be the "query." If there were ambiguous areas of your sequencing results, these will be listed as "N" rather than "A" "T" "G" or "C" and it's fine to include Ns in the query.
- Paste the inverse pericam sequence into the "Subject" box.
- Click on the BLAST button. Matches will be shown by vertical lines between the aligned sequences. You should see a long stream of matches, followed by lots of errors in the last ~200bp of the sequence – ignore the error-ridden part of the data, as it may not accurately reflect your mutant plasmid. In this stream of matches, the 1-3 missing lines indicating your mutant codon should stand out. If they don’t, use the numbering or Find tool to locate the appropriate codon.
- You should print a screenshot of each alignment to pdf (and to paper if you desire). These will be used to prepare a figure showing what you found today. You might want to email yourself the alignment screen shots or post them to your wiki userpage.


