20.109(S13):Context-setting and primer design (Day1)
From OpenWetWare
(→Part 2: Explore existing microsporidia-specific primers) |
(→Part 2: Explore existing microsporidia-specific primers) |
||
| Line 47: | Line 47: | ||
===Part 2: Explore existing microsporidia-specific primers=== | ===Part 2: Explore existing microsporidia-specific primers=== | ||
| - | + | The default primer set that you will use to amplify microsporidia DNA comes from a 1999 paper from Franzen lab (link). These primers anneal to the 5' end of the small subunit (SSU) rRNA gene. | |
| + | |||
| + | <center> | ||
| + | {| border="1" | ||
| + | ! Primer name | ||
| + | ! Direction | ||
| + | ! Sequence (5'-->3') | ||
| + | |- | ||
| + | | V1 | ||
| + | | Forward | ||
| + | | CACCAGGTTGATTCTGCCTGAC | ||
| + | |- | ||
| + | | PMP2 | ||
| + | | Reverse | ||
| + | | CCTCTCCGGAACCAAACCCTG | ||
| + | |- | ||
| + | |} | ||
| + | </center> | ||
| + | |||
| + | First, let's assess some basic properties of these primers. Then we'll calculate expected product sizes for several different species of microsporidia. | ||
give them an E hellem accession number, have them find an E bienusi and E cuniculi, and find expected sizes for each species with this primer set | give them an E hellem accession number, have them find an E bienusi and E cuniculi, and find expected sizes for each species with this primer set | ||
Revision as of 15:00, 18 January 2013
Contents |
Introduction
In this module, you'll perform two investigations of pathogens that can infect birds. Through bird stool, these pathogens can be transferred to the environment –– and in some cases infect other animals. Perhaps the most well-known avian pathogen with zoonotic potential (i.e., inter-species transmission) is the flu virus. For your safety, all the samples we will work with have been screened to exclude those carrying human–pathogenic flu strains. However, we will be able to mine much of the same intellectual content that we could were we studying flu directly.
Prof. Runstadler, the lecturer for this module, studies phylogenetic relationships among avian flus [cite 2012 virology paper]. Tracking viral mutations/evolution, infection of different bird species (including co-infection by multiple strains), and the trafficking patterns of those birds may provide information useful for predicting the next flu pandemic and commencing vaccine production in time. Your own phylogenetic analysis will consist of comparing bacterial communities in two distinct bird populations. (We admit, not as flashy as studying the flu!) More about the significance of that research next time.
Your other research project will pertain to an unusual fungus called microsporidia. Your other research project will pertain to an unusual fungus called microsporidia. Specifically, today you will attempt to design PCR primers that improve upon the sensitivity and/or specificity of the state-of-the-art in microsporidia identification. This experience will give you a sense of the importance of methods for successful scientific investigation.
By way of background, the phylum microsporidia contains over 1000 known species. Microsporidia are parasites that require a eukaryotic host cell for propagation; only in the spore stage of their life cycle can this pathogen independently survive. About a dozen species of microsporidia can infect humans, and many more infect other animals – including animals used by humans for production of food and materials. To infect their hosts, microsporidia use a unique projection called a polar tube.
Based on the apparent absence or simplification of many canonical eukaryotic features, it was once proposed that microsporidia must be primitive eukaryotes whose evolution pre-dated mitochondria. It turns out that microsporidia do have “mitosomes,” and rather than being primitive, these organelles evolved to this simpler form because their function has primarily been outsourced to the host. Phylogenetic analysis was the linchpin that resolved the competing hypotheses about microsporidial origin! Relational trees similar to the ones that you will make to describe bacterial populations in seagulls revealed that microsporidia evolved later than initially thought and are a fungus rather than protist. [Keeling and Slmovits]
A robust diagnostic for identifying infection by microsporidia – microsporidiosis – is of interest for several reasons related to both prevention and treatment. With respect to treatment, specifically identifying a causative agent for disease can sometimes suggest an appropriate course of action, for example by providing knowledge of the pathogen's drug resistance profile. With respect to prevention, it is useful to think about potential sources of human infection. Environmental sources associated with microsporidiosis risk include bodies of water. Testing reservoirs and other important water sources can provide guidance to at-risk poulations (primarily HIV patients, along with other immunocompromised individuals), whether it be to drink bottled water or to avoid traveling to a certain country. It is also speculated that some strains of microsporidia have zoonotic potential, that is, they may be transferred from animals to humans; in this case, at-risk populations may need to test their pets or avoid certain types of pets.. Here, molecular diagnostics are particularly useful because there is already evidence pertaining to some species of microsporidia indicating that certain genotypes infect only humans, others only a non-human animal host, and still others infect both human and animal and thus suggest zoonotic transfer. Finally, infections can of course be transmitted from person to person. Here, sensitive diagnostics are especially important because in some cases infections can be asymptomatic but potentially transmissible. [Didier/Weiss and Mathis et al]
Traditionally, many pathogens were identified by imaging techniques for morphology and culturing techniques for probing phenotype. Recently, molecular identification has emerged as a powerful and perhaps less subjective technique. Specific sequences in the pathogens' DNA can be targeted by unique primers and amplified in a polymerase chain reaction (PCR). Notably, there are conflicting reports as to whether sequence-based identification is any more sensitive than imaging when it comes to microsporidia. (cite that paper)
Identification according to sequence requires a highly conserved gene. Ribosomal RNA is an excellent candidate for this strategy, as it is essential for life and thus the organism is unlikely to survive rRNA mutation. Depending on the pathogen, different subunits or also the internal transcribed sequence might be the most reliable or otherwise preferred sequences[UGH sentence revise]. In the case of microsporidia, we will start with primers that target the 5' end of the small subunit rRNA. You will have the option of targeting a different portion of the rRNA or a coat protein unique to microsporidia [NOT CERTAIN YET, as described in the protocols below.
- figures
- figs 1+2 from mathis for microsporidia
- schematic overview of the two experimental goals
- things to cite somewhere above:
- Clarridge review re: 16S rRNA importance in general (if bacteria-focused, hmmm)
- Mathis et al review re: zoonotic potential of μSP
- Garcia re: μSP identification
- some of the more primer-specific μSP papers, perhaps in protocols below
- A fun summary with many references is at PLOS pathogens here: http://www.plospathogens.org/article/info%3Adoi%2F10.1371%2Fjournal.ppat.1000489
- primer design basic background here or directly in protocols?
likely the latter. and definitely should be explaining full PCR cycle on D2, not waiting till D3
Protocols
Part 1: Lab practical
You and your partner may work together on the lab practical. (Note: this will not be the case for future quizzes.) You are of course welcome to give different answers should you disagree.
Part 2: Explore existing microsporidia-specific primers
The default primer set that you will use to amplify microsporidia DNA comes from a 1999 paper from Franzen lab (link). These primers anneal to the 5' end of the small subunit (SSU) rRNA gene.
| Primer name | Direction | Sequence (5'-->3') |
|---|---|---|
| V1 | Forward | CACCAGGTTGATTCTGCCTGAC |
| PMP2 | Reverse | CCTCTCCGGAACCAAACCCTG |
First, let's assess some basic properties of these primers. Then we'll calculate expected product sizes for several different species of microsporidia.
give them an E hellem accession number, have them find an E bienusi and E cuniculi, and find expected sizes for each species with this primer set (or lead through E hellem, then give accession number but no size for bienusi, and finally alone for cuniculi... ?)
G/C contents very standard
surprisingly, Ta's high compared to Tm's... may suggest issues with specificity...
check also hairpins and dimers in IDT as baseline
they made confirmation primers for bienusi and intestinalis -- design challenge 1: can you make for e hellem? (or possibly multiple pair-wise comparison options)
in our conditions, these primers are sensitive to [X] of the positive control DNA -- design challenge 2: can you make primers with a lower detection limit...


