20.109(S07):Start-up genome engineering

Introduction

How many genetically-encoded creatures exist in every milliliter of sea water? 100? 1000? More? It turns out that bacteria are by far the best represented life form, numbering up to a million cells/ml. If each cell is assumed to harbor the DNA content of pedestrian E. coli MG1655, then that means 10^12th base pairs of DNA/ml. This thriving gene pool is even more remarkable in light of the fact that each ml of sea water contains approximately10^10th viruses that infect bacteria, aka bacteriophage or “phage” for short. These destroy half the world's bacterial population every 48 hours [2]. Given the huge number of bacteriophage that exist, it's probably not surprising that most of the earth’s bacteriophage are completely uncharacterized, though massive genome sequencing efforts are underway.

A few bacteriophage are exquisitely well characterized. Indeed, the study of phage laid much of the groundwork for our current understanding of genetics and molecular principles in biology. These principles carry over to the biology of more complex cells (Jacques Monod famously said “What is true for Escherichia coli is true for the elephant” [Francois Jacob (1988)]). M13 is a member of the filamentous phage family. It has a long (~900 nm), narrow (~20 nm) protein coat that encases a small (~6.4 kb) single stranded DNA genome. The genome encodes 11 proteins, five of which are exposed on the phage’s protein coat and six of which are involved in phage maturation inside its E. coli host.

Phage Particles

The phage coat is primarily assembled from a 50 amino acid protein called pVIII (or p8), which is sensibly enough encoded by gene VIII (or g8) in the phage genome. For a wild type M13 particle, it takes about ~2700 copies of p8 to make the ~900 nm long coat. The coat's dimensions are flexible though and the number of p8 copies adjusts to accommodate the size of the single stranded genome it packages. For example, when the phage genome was mutated to reduce its number of DNA bases (from 6.4 kb to 221 bp) [[3]], (image courtesy of Esther Bullitt, Boston University School of Medicine), then the p8 coat “shrink wraps" around the reduced genome, decreasing the number of p8 copies to less than 100. Electron micrographs of the resulting “microphage” and its wild type parent are shown below, where the black bar in each image is 50 nm long. And what about the upper limit to the length of the phage particle? Anecdotally, viable phage seems to top out at approximately twice the natural DNA content. However, deletion of a phage protein (p3) prevents full escape from the host E. coli, and phage that are 10-20X the normal length with several copies of the phage genome can be seen shedding from the E. coli host (look at the image on the coverpage to this module).

Electron micrographs of microphage described by Specthrie et al[[1]], images courtesy of Esther Bullitt

There are four other proteins on the phage surface, two of which have been extensively studied. At one end of the filament are five copies of the surface exposed pIX (p9) and a more buried companion protein, pVII (p7). If p8 forms the shaft of the phage, p9 and p7 form the “blunt” end that’s seen in the micrographs. These proteins are some of the smallest known (only 33 and 32 amino acids), though some additional residues can be added to the N-terminal portion of each which are then presented on the “outside” of the phage coat (much more on this technique later). At the other end of the phage particle are five copies of the surface exposed pIII (p3) and its less exposed accessory protein, pVI (p6). These form the rounded tip of the phage and are the first proteins to interact with the E. coli host during infection. p3 is also the last point of contact with the host as new phage bud from the bacterial surface.

Phage life-cycle

The general stages to a viral life cycle are: infection, replication of the viral genome, assembly of new viral particles and then release of the progeny particles from the host. Filamentous phage use a bacterial structure known as the F pilus to infect E. coli, with the M13 p3 tip contacting the TolA protein on the bacterial pilus. The phage genome is then transferred to the cytoplasm of the bacterial cell where resident proteins convert the single stranded DNA genome to a double stranded replicative form (“RF”). This DNA then serves as a template for expression of the phage genes.

Two phage gene products play critical roles in the next stage of the phage life cycle, namely amplification of the genome. pII (aka p2) nicks the double stranded form of the genome to initiate replication of the + strand. Without p2, no replication of the phage genome can occur. Host enzymes copy the replicated + strand, resulting in more copies of double stranded phage DNA. pV (aka p5) competes with double stranded DNA formation by sequestering copies of the + stranded DNA into a protein/DNA complex destined for packaging into new phage particles. Interestingly there is one additional phage-encoded protein, pX (p10), that is important for regulating the number of double stranded genomes in the bacterial host. Without p10 no + strands can accumulate. What's particularly interesting about p10 is that it's identical to the C-terminal portion of p2 since the gene for p10 is within the gene for p2 and the protein arises from transcription initiation within gene 2. This makes the manipulation of p10 inextricably linked to manipulation of p2 (an engineering headache) but it also makes for a compact and efficient phage in nature.

cartoon of phage life cycle

Phage maturation requires the phage-encoded proteins pIV (p4), pI (p1) and its translational restart product pXI (p11). Multiple copies (on the order of 12 or 14) of p4 assemble in the outer membrane into a stable, i.e. detergent resistant, barrel-shaped structure. Similarly a handful of the p1 and p11 proteins (5 or 6 copies of each) assemble in the bacterial inner membrane, and genetic evidence suggests C-terminal portions of p1 and p11 interact with the N-terminal portion of p4 in the periplasm. Together the p1, p11, p4 complex forms channels through which mature phage are secreted from the bacterial host.

To initiate phage secretion, two of the minor phage coat proteins, p9 and p7, are thought to interact with the p5-single stranded DNA complex at a region of the DNA called the packaging sequence (aka PS). The p5 proteins covering the single stranded DNA are then replaced by p8 proteins that are embedded in the bacterial membrane and the growing phage filament is threaded through the p1, p11, p4 channel. This replacement of p5 by p8 explains the microphage data presented earlier...making very clear how the size of the phage particle is determined by the number of bases the phage packages. Once the phage DNA has been fully coated with p8, the secretion terminates by adding the p3/p6 cap, and the new phage detaches from the bacterial surface. How long does all this take? Amazingly, new M13 phage particles are secreted within 10 minutes from a newly infected host and can arise at a rate of 1000/cell within the first hour of infection. Also amazing is how the bacterial host can continue to grow and divide, allowing this process to continue indefinitely.

protein	function
I	assembly
II	replication of DNA + strand
III	phage tail protein (5 copies)
IV	assembly
V	binds ssDNA
VI	phage tail protein (5 copies)
VII	phage head protein (5 copies)
VIII	phage coat protein (2700 copies)
IX	phage head protein (5 copies)
X	DNA replication
XI	assembly

Protocols

As you heard about in lecture, you’ll be starting a project to study the M13 genome and in the process you’ll be learning some fundamental tools and techniques of molecular biology. One major goal we have for this module is to establish good habits for documentation of your work. By documenting your work according to the exercises done today, you will

• Be better research students (in BE.109 as well as any research lab you may join)
• Be better writers since a clear record of what you’ve done will improve your data analysis
• Be better scientists, since you’ll eventually train others to document things this way too

Today’s lab has four parts. First, you and your partner will complete the lab practical we have set up for you. Second, you and your lab partner will annotate the M13K07 genome map, identifying trouble spots suitable for re-engineering. Next you will follow a four-part exercise to design a pair of oligonucleotide primers for adding an epitope tag to one of two proteins encoded by the M13 genome. Finally, you will begin to prepare the M13 backbone needed for epitope tagging. Next time you’ll start cloning the primers product.

Part 1: lab practical

Good luck!

Part 2: M13K07 renovation

You are about to undertake an ambitious project, namely a complete renovation of the M13 genome. If you’re successful, the renovated genome will be a better substrate for further engineering. It will consist of discrete, insulated elements that might, later on, be re-used, tured and rationally modified with ease. Refining the genome won’t be easy. Nature has optimized the existing pahge in response to evolutionary pressures and it will be a lot easier for you to kill it than to improve it. But we have a few powerful resources to draw from: full sequence data is available for the M13 genome and some of its close relatives; clever genetic experiments have defined the functionally relevant parts; structural data gives us a view of the phage particle and its components. Together these provide detailed, though not complete, understanding of the workings of the phage. And the beauty of this experiment is how your genome renovation, once built and tested, will feedback and add to the existing base of knowledge.

Today you will begin your begin your renovation with a detailed evaluation of the natural existence, identifying parts of the genome crying out for re-engineering. Annotate the M13K07 genome printout in the following way.

1. change the PstI site (CTGCAG) at position 8083 to an EcoRI site (GAATTC).
2. change the T at position 1372 to an A, making a PstI site.
3. box the unique BamHI site (GGATCC) that starts at position 2220.
4. use the information printed at the start of your M13K07 sequence to box the start and stop codons for genes I through XI. # sumarize in your notebook any instances where modification of one gene affects the sequence of another.

Part 3: Digest M13K07

Restriction endonucleases, also called restriction enzymes, cut (“digest”) DNA at specific sequences of bases. The restriction enzymes are named for the prokaryotic organism from which they were isolated. For example, the restriction endonuclease EcoRI (pronounced “echo-are-one”) was originally isolated from E. coli giving it the “Eco” part of the name. “RI” indicates the particular version on the E. coli strain (RY13) and the fact that it was the first restriction enzyme isolated from this strain.

The sequence of DNA that is bound and cleaved by an endonuclease is called the recognition sequence or restriction site. These sequences are usually four or six base pairs long and palindromic, that is, they read the same 5’ to 3’ on the top and bottom strand of DNA. For example the recognition sequence for EcoRI is

5’ GAATTC 3’
3’ CTTAAG 5’

EcoRI cuts between the G and the A on each strand of DNA, leaving a single stranded DNA overhang (also called a “sticky end”) when the strands separate.

Other restriction enzymes, for example HaeIII, cut in the middle of the palindrome leaving no DNA overhang, called a “blunt end.” One of the most useful resources for information restriction enzyme information is the website from New England Biolabs [homepage]. Use their search engine to retrieve information about the recognition enzymes SmaI and XmaI. Be sure you are clear on how they differ before you move on to the experiment. For example, do the enzymes have the same recognition sites? do they leave the same overhang? will they work in the same buffer? at the same temperature? These are some of the preliminary questions you'll have to ask yourself whenever you set up a restriction digest.

Next use the NEB website or the paper copy of their catalog to look up the recognition sites for the enzymes PstI and BamHI. What overhangs do they leave? what buffer is recommended? what temperature? You will perform a restriction digest with one of these two enzymes today. Your choice will depend on which of the M13 proteins you would like to modify. A PstI digest linearizes the M13K07 genome at the gene for p8 whereas a BamHI digest cuts the gene for p3. You and your partner should decide which protein you would like to modify and choose one of the following protocols to follow:

	to modify g8	to modify g3
DNA	5 ul M13K07	5 ul M13K07
H2O	to a final volume of 25 ul	to a final volume of 25 ul
buffer (as directed by NEB)
enzyme	0.5 ul PstI	0.5 ul BamHI

Part 4: M13K07 tag

[general info about epitope tagging with PCR]
[genetic code]
[RE finder to help with primer design]
Generalize instructions as:

• reverse translate epitope
• add overhangs for cloning
• check reading frame
• destroy restriction site from bkb
• add RE site either via silent changes or to restore reading frame or by adding aa

g8p

File:Macintosh HD-Users-nkuldell-Desktop-g8p M13K07+Pst.doc [UniprotKB entry]
Insert tag at Pst in g8p M13K07 after SDM with NO135/136

• HA
  • 9-amino acid sequence (YPYDVPDYA) recognized by the anti-12CA5 (=anti-HA)
  • reverse translate at [|Gene Design]
  • default settings gives sequence: TACCCATATGATGTTCCGGACTACGCT
  • add silent restriction sites. Considered all degeneracies of codons, found can silently insert AatII in middle of tag as: TACCCATATGAcGTcCCGGACTACGCa gives AatII site which is not naturally in M13KO7.
    • alternatively add Val to N-term end of tag where val tyr encoded by GTA TAC = unique BstZ171 site
    • alternatively add Ser to C-term end of tag so prot seq reads:...asp tyr ala ser cys...where ala ser encoded by GCT AGC = unique NheI site
  • add Pst tails for ligation, using last t of Ala codon as first base for Pst overhang...this requires that the bottom primer not base pair to that position.
    • NO140 g8p_HA_top: TAC CCA TAT GAC GTC CCG GAC TAC GCt gca
    • NO141 g8p_HA_btm: acgt ATG GGT ATA CTG CAG GGC CTG ATG CG
    • resulting tag is 10aa (9aaHA+Ala) then back in frame with g8 seq at Glu25

• c-myc
  • 10-amino acid sequence (EQKLISEEDL) recognized by anti-9E10 (=anti-myc)
  • reverse translate at [|Gene Design]
  • default settings gives sequence: GAACAGAAACTGATCTCTGAAGAAGACCTG
  • add silent restriction site. Considered all degeneracies of codons, found can silently insert HindIII in middle of tag as: GAACAGAAgCTtATCTCTGAAGAAGACCTG

(there is second HindIII in M13K07 at 7402, so construct with insert should give fragment plus bkb.

• • add Pst tails for ligation using last t of Leu codon as first base for Pst overhang...this requires that the bottom primer not base pair to that position.
    • NO142 g8p_myc_top: GAA CAG AAg CTt ATC TCT GAA GAA GAC CTt gca
    • NO143 g8p_myc_btm: acgt CTT GTC TTC GAA TAG AGA CTT CTT CTG GA
    • resulting tag is 11aa (10aa c-myc+Ala) then back in frame with g8 seq at Glu25

g3p

File:Macintosh HD-Users-nkuldell-Desktop-g3p M13KO7translated.doc [UniProtKB entry]
Insert tag at natural unique BamHI in g3p M13K07.
For consistency used version after SDM with NO135/136 but if these silent changes attenuate phage, may want to try in wtM13KO7
Note from CN at NEB 11.1.06:
The Bam site in wt M13 (and M13KO7) overlaps residues 196-198 of pIII, which fall in the domain (D2) which is involved in F-pilus binding (i.e. the first step in phage infection). Deng and Perham (J Mol Biol 319, 603-614, 2002) characterized a series of mutants to delineate the precise F-pilus binding site of D2, and found that the interaction occurs at a loop comprising residues 178-199, which happens to contain the BamHI site. The good news is that this is a solvent-exposed loop; the bad news is that insertions here might disrupt F-pilus binding, resulting in non-infectious phage. (FYI, in the mp versions of M13, and our PhD cloning vector M13KE, the 2 C's in the Bam site are replaced by T's, resulting in Pro198 being Leu, which has no effect on phage infectivity.) So the short answer is that while there are good reasons to expect that insertions at the Bam site would not be tolerated, you might want to try it anyway.

• HA
  • 9-amino acid sequence (YPYDVPDYA) recognized by the anti-12CA5 (=anti-HA)
  • reverse translate at [|Gene Design]
  • default settings gives sequence: TACCCATATGATGTTCCGGACTACGCT
  • add silent restriction site: TACCCATATGAcGTcCCGGACTACGCT gives AatII site which is not naturally in M13KO7.
  • add Bam tails for ligation, changing last T of Ala codon to G (also Ala) as first base for Bam overhang...this requires that the top primer not base pair to that position.
    • NO144 g3p_HA_top: gat cca TAC CCA TAT GAC GTC CCG GAC TAC GC
    • NO145 g3p_HA_btm: gt ATG GGT ATA CTG CAG GGC CTG ATG CGc tag
    • resulting tag starts after g3 Pro216, inserting 10aa (9aaHA+Ile) then back in frame with g3 seq at Phe217

• c-myc
  • 10-amino acid sequence (EQKLISEEDL) recognized by anti-9E10 (=anti-myc)
  • reverse translate at [|Gene Design]
  • default settings gives sequence: GAACAGAAACTGATCTCTGAAGAAGACCTG
  • add silent restriction site. Considered all degeneracies of codons, found can silently insert HindIII in middle of tag as: GAACAGAAgCTtATCTCTGAAGAAGACCTG

(there is second HindIII in M13K07 at 7402, so construct with insert should give fragment plus bkb.

• • add Bam tails for ligation, removing last G of Leu codon from top primer to use as first base for Bam overhang, followed by unpaired TAG on bottom primer for Bam site. This inserts Ile into tag.
    • NO146 g3p_myc_top: gat cca GAA CAG AAg CTt ATC TCT GAA GAA GAC CT
    • NO147 g3p_myc_btm: gt CTT GTC TTC GAA TAG AGA CTT CTT CTG GAc tag
    • resulting tag starts after g3 Pro216, inserting 11aa (10aa c-myc+Ile) then back in frame with g3 seq at Phe217

design oligos for epitope tagging (order?)

DONE!

For next time

1. The major writing assignment for this module will be a description of your M13 renovation work. Use the summary in your lab notebook to start a table on your wiki user page to organize your thoughts about the existing genome. Generate a table that lists each gene and any re-engineering ideas you have for it. Print out this table to hand in next time.